Loading...
HomeMy WebLinkAbout02.09.21 Public Comment Packet Clerk of the Board Andy Pickett Chief Administrative Officer and Clerk of the Board 25 County Center Drive, Suite 200 T: 530.552.3300 buttecounty.net/administration Oroville, California 95965 F: 530.538.7120 Members of the Board Bill Connelly | Debra Lucero | Tami Ritter | Tod Kimmelshue | Doug Teeter MEMORANDUM DATE: February 11, 2021 RE: Public Comment Submitted for February 9, 2021 Butte County Board of Supervisors Meeting Pursuant to current State Public Health directives to shelter-in-place and practice social distancing due to the COVID19 pandemic, and as authorized by Governor Gavin Newsom’s Executive Orders N-25-20 and N-29-20, the meeting was closed to the public and all non-essential County staff. Members of the public were encouraged to participate remotely from a safe location by submitting comments electronically or registering to speak live via the online platform WebEx. Enclosed please find all public comment submitted for the February 9, 2021 Board of Supervisors Meeting. Amy Schuman Associate Clerk of the Board Clerk of the Board Andy Pickett Chief Administrative Officer and Clerk of the Board 25 County Center Drive, Suite 200 T: 530.552.3300 buttecounty.net/administration Oroville, California 95965 F: 530.538.7120 Members of the Board Bill Connelly | Debra Lucero | Tami Ritter | Tod Kimmelshue | Doug Teeter MEMORANDUM DATE: February 11, 2021 RE: Public Comment Submitted for February 9, 2021 Butte County Board of Supervisors Meeting Consent Agenda Pursuant to current State Public Health directives to shelter-in-place and practice social distancing due to the COVID19 pandemic, and as authorized by Governor Gavin Newsom’s Executive Orders N-25-20 and N-29-20, the meeting was closed to the public and all non-essential County staff. Members of the public were encouraged to participate remotely from a safe location by submitting comments electronically. Enclosed please find all public comment related to the Consent Agenda at the February 9, 2021 Board of Supervisors Meeting. Amy Schuman Associate Clerk of the Board From:Jill A Vought To:Clerk of the Board Subject:To Be Considered for the 2/9/2021 Date:Monday, February 8, 2021 5:08:49 PM ATTENTION: This message originated from outside Butte County. Please exercise judgment before opening .. attachments, clicking on links, or replying. I am writing to ask some questions and hope that some considerations will be taken regarding item 3.05. I am asking about ornamental landscaping that is on timed irrigation systems ( battery backed up timers in light of PGE PSPS 'S) being considered in the 5' and 10' zones being proposed by 3.05. I am aware that this proposal is in the newly written CA Dept of Forestry as well but neither document discusses if you are referring to ornamental plants or lawns that arebeing watered and manicured. There is just vegetation mentioned which is not specific. We have spent thousands on our landscaping and this proposal would cause us to lose our entire front yard and all the areas in our backyard that are near the home. Our home survived the campfire in part to our gravel rock ground cover, the fire resistant fencing near our home, the "hardness" of our home and the green and watered well spaced landscaping. We have always passed CAL FIRE inspections in our 18 years of living in Magalia. We live in the POA area of the burn scar and are one of the few who have re- landscaped or 1/4 acre. We live on a cul de sac with a hydrant 2 houses from our home. We completely understand and support the great need for enhanced fire safety in our area...we are the one home that always has the clean roof and gutters, the manicured yard and irrigation set up for our entire quarter acre. I am hoping that some consideration for existing homes with ornamental landscaping can be taken into consideration. There is a huge difference between large dry bushes or weeds being near the home and street and green watered landscaping plants, lawns etc. With newly constructed lots and homes this level of compliance may be easier to achieve if homeowners have not begun the process of planting a yard. For those of us with existing yards you are asking for a loss of hundreds if not thousands of dollars of our hard earned dollars to remove and lose expensive plants. Please consider adding more clarity to this item ...Thank You Michael and Jill Vought 13621 Lander Ct Magalia Ca From:John S. To:Clerk of the Board Subject:comment on item 3.05 chapter 38A rewrite Date:Tuesday, February 9, 2021 8:39:59 AM .ATTENTION: This message originated from outside Butte County. Please exercise judgment before opening attachments, clicking on links, or replying.. I support the stated intent of this ordinance but not the proposed language which contravenes that intent. Computer programmers become conscious of the perils of uninitialized variables and inaccurate syntax. You are about to pass an ordinance which literally reads "Vegetation within ten (10) feet of a street or driveway shall be cut to (4) inches or less above ground." There is obviously a word missing here -- the word "four" -- and a word less obviously missing -- the word "Hazardous." In the spring of 2018, Nancy Springer and Curtis Johnson led workshops to revise the Limited-Density Owner-Built Rural Dwelling Ordinance. Citizens from Concow and elsewhere, Dot Morris in particular, helped craft a good piece of legislation that passed the Board unanimously. Also in 2018, extensive citizen input was sought and obtained to create an Oak Woodland Mitigation ordinance. That led to an unsatisfactory compromise which some considered too weak and others considered too stringent. It failed to pass, and while there were instructions to bring it back, that has not yet occurred. Chapter 38A was rewritten behind closed doors. The public workshops Dot and I called for in June never took place, and flaws the public could have uncovered and corrected given the chance instead remain in the ordinance before you today. Chief Messina assures me it will not be enforced to the letter of the law, but it would be best to get the language right before chaptering. As the problems with this piece of legislation become apparent, I urge you to include citizen input in its inevitable revision. It can and should be reworked to protect Buildings from fire, to unambiguously protect street trees, and to withstand environmental challenges. John Stonebraker Magalia, CA Clerk of the Board Andy Pickett Chief Administrative Officer and Clerk of the Board 25 County Center Drive, Suite 200 T: 530.552.3300 buttecounty.net/administration Oroville, California 95965 F: 530.538.7120 Members of the Board Bill Connelly | Debra Lucero | Tami Ritter | Tod Kimmelshue | Doug Teeter MEMORANDUM DATE: February 11, 2021 RE: Public Comment Submitted for February 9, 2021 Butte County Board of Supervisors Meeting Item 4.01.A.1 – Appointment to the Northern Rural Training and Employment Consortium (NoRTEC) Pursuant to current State Public Health directives to shelter-in-place and practice social distancing due to the COVID19 pandemic, and as authorized by Governor Gavin Newsom’s Executive Orders N-25-20 and N-29-20, the meeting was closed to the public and all non-essential County staff. Members of the public were encouraged to participate remotely from a safe location by submitting comments electronically. Enclosed please find all public comment related to Item 4.01.A.1 at the February 9, 2021 Board of Supervisors Meeting. Amy Schuman Associate Clerk of the Board Clerk of the Board Andy Pickett Chief Administrative Officer and Clerk of the Board 25 County Center Drive, Suite 200 T: 530.552.3300 buttecounty.net/administration Oroville, California 95965 F: 530.538.7120 Members of the Board Bill Connelly | Debra Lucero | Tami Ritter | Tod Kimmelshue | Doug Teeter MEMORANDUM DATE: February 11, 2021 RE: Public Comment Submitted for February 9, 2021 Butte County Board of Supervisors Meeting Item 4.01.A.3 – Appointments to the Butte County Water Commission Pursuant to current State Public Health directives to shelter-in-place and practice social distancing due to the COVID19 pandemic, and as authorized by Governor Gavin Newsom’s Executive Orders N-25-20 and N-29-20, the meeting was closed to the public and all non-essential County staff. Members of the public were encouraged to participate remotely from a safe location by submitting comments electronically. Enclosed please find all public comment related to Item 4.01.A.3 at the February 9, 2021 Board of Supervisors Meeting. Amy Schuman Associate Clerk of the Board Board of Supervisors Meeting- Speaker Report Regular Meeting – February 9, 2021 Speaker: Clifford Jacobson Item for Comment: 4.01A3 Appointments to the Butte County Water Commission Platform: Registered to Participate on WebEx, was not able to get into meeting virtually. County Moderator made several attempts to call him into meeting instead but phone was not answered. Clerk of the Board Andy Pickett Chief Administrative Officer and Clerk of the Board 25 County Center Drive, Suite 200 T: 530.552.3300 buttecounty.net/administration Oroville, California 95965 F: 530.538.7120 Members of the Board Bill Connelly | Debra Lucero | Tami Ritter | Tod Kimmelshue | Doug Teeter MEMORANDUM DATE: February 11, 2021 RE: Public Comment Submitted for February 9, 2021 Butte County Board of Supervisors Meeting Item 4.02A – COVID-19 Update by the Public Health Director Pursuant to current State Public Health directives to shelter-in-place and practice social distancing due to the COVID19 pandemic, and as authorized by Governor Gavin Newsom’s Executive Orders N-25-20 and N-29-20, the meeting was closed to the public and all non-essential County staff. Members of the public were encouraged to participate remotely from a safe location by submitting comments electronically. Enclosed please find all public comment related to Item 4.02A at the February 9, 2021 Board of Supervisors Meeting. Amy Schuman Associate Clerk of the Board Clerk of the Board Andy Pickett Chief Administrative Officer and Clerk of the Board 25 County Center Drive, Suite 200 T: 530.552.3300 buttecounty.net/administration Oroville, California 95965 F: 530.538.7120 Members of the Board Bill Connelly | Debra Lucero | Tami Ritter | Tod Kimmelshue | Doug Teeter MEMORANDUM DATE: February 11, 2021 RE: Public Comment Submitted for February 9, 2021 Butte County Board of Supervisors Meeting Item 4.03 – Discussion Regarding the County’s Recruitment Process for Boards, Committees, and Commissions (BCCs) Pursuant to current State Public Health directives to shelter-in-place and practice social distancing due to the COVID19 pandemic, and as authorized by Governor Gavin Newsom’s Executive Orders N-25-20 and N-29-20, the meeting was closed to the public and all non-essential County staff. Members of the public were encouraged to participate remotely from a safe location by submitting comments electronically. Enclosed please find all public comment related to Item 4.03 at the February 9, 2021 Board of Supervisors Meeting. Amy Schuman Associate Clerk of the Board Clerk of the Board Andy Pickett Chief Administrative Officer and Clerk of the Board 25 County Center Drive, Suite 200 T: 530.552.3300 buttecounty.net/administration Oroville, California 95965 F: 530.538.7120 Members of the Board Bill Connelly | Debra Lucero | Tami Ritter | Tod Kimmelshue | Doug Teeter MEMORANDUM DATE: February 11, 2021 RE: Public Comment Submitted for February 9, 2021 Butte County Board of Supervisors Meeting Item 4.05 – California State Operated Emergency Rental Assistance Program Pursuant to current State Public Health directives to shelter-in-place and practice social distancing due to the COVID19 pandemic, and as authorized by Governor Gavin Newsom’s Executive Orders N-25-20 and N-29-20, the meeting was closed to the public and all non-essential County staff. Members of the public were encouraged to participate remotely from a safe location by submitting comments electronically. Enclosed please find all public comment related to Item 4.05 at the February 9, 2021 Board of Supervisors Meeting. Amy Schuman Associate Clerk of the Board Clerk of the Board Andy Pickett Chief Administrative Officer and Clerk of the Board 25 County Center Drive, Suite 200 T: 530.552.3300 buttecounty.net/administration Oroville, California 95965 F: 530.538.7120 Members of the Board Bill Connelly | Debra Lucero | Tami Ritter | Tod Kimmelshue | Doug Teeter MEMORANDUM DATE: February 11, 2021 RE: Public Comment Submitted for February 9, 2021 Butte County Board of Supervisors Meeting Item 4.06 – Resolution Supporting Healthy Communities Approach to COVID-19 Local Restrictions Pursuant to current State Public Health directives to shelter-in-place and practice social distancing due to the COVID19 pandemic, and as authorized by Governor Gavin Newsom’s Executive Orders N-25-20 and N-29-20, the meeting was closed to the public and all non-essential County staff. Members of the public were encouraged to participate remotely from a safe location by submitting comments electronically. Enclosed please find all public comment related to Item 4.06 at the February 9, 2021 Board of Supervisors Meeting. Amy Schuman Associate Clerk of the Board Clerk of the Board Andy Pickett Chief Administrative Officer and Clerk of the Board 25 County Center Drive, Suite 200 T: 530.552.3300 buttecounty.net/administration Oroville, California 95965 F: 530.538.7120 Members of the Board Bill Connelly | Debra Lucero | Tami Ritter | Tod Kimmelshue | Doug Teeter MEMORANDUM DATE: February 11, 2021 RE: Public Comment Submitted for February 9, 2021 Butte County Board of Supervisors Meeting Item 5.02 – Timed Item - Presentation from the Town of Paradise about the Paradise Sewer Project Camp Fire Recovery Efforts Pursuant to current State Public Health directives to shelter-in-place and practice social distancing due to the COVID19 pandemic, and as authorized by Governor Gavin Newsom’s Executive Orders N-25-20 and N-29-20, the meeting was closed to the public and all non-essential County staff. Members of the public were encouraged to participate remotely from a safe location by submitting comments electronically. Enclosed please find all public comment related to Item 5.02 at the February 9, 2021 Board of Supervisors Meeting. Amy Schuman Associate Clerk of the Board Board of Supervisors Meeting- Speaker Report Regular Meeting – February 9, 2021 Speaker: John Stonebraker Item for Comment: 5.02 – Timed Item- Presentation from the Town of Paradise about the Paradise Sewer Project Camp Fire Recovery Efforts. Platform: WebEx Clerk of the Board Andy Pickett Chief Administrative Officer and Clerk of the Board 25 County Center Drive, Suite 200 T: 530.552.3300 buttecounty.net/administration Oroville, California 95965 F: 530.538.7120 Members of the Board Bill Connelly | Debra Lucero | Tami Ritter | Tod Kimmelshue | Doug Teeter MEMORANDUM DATE: February 11, 2021 RE: Public Comment Submitted for February 9, 2021 Butte County Board of Supervisors Meeting Item 5.03 – 1:00PM - Timed Item - Program Update on Exceptions to Agricultural Buffer Setbacks Pursuant to Butte County Code Section 24-84 of the Zoning Ordinance Pursuant to current State Public Health directives to shelter-in-place and practice social distancing due to the COVID19 pandemic, and as authorized by Governor Gavin Newsom’s Executive Orders N-25-20 and N-29-20, the meeting was closed to the public and all non-essential County staff. Members of the public were encouraged to participate remotely from a safe location by submitting comments electronically. Enclosed please find all public comment related to Item 5.03 at the February 9, 2021 Board of Supervisors Meeting. Amy Schuman Associate Clerk of the Board From:Schuman, Amy To:BOS Cc:Mendoza, Louie;Daneluk, Paula;Johnson, Uriah;Hatcher, Casey Subject:Public Comment 2/9/21 Item 5.03 - Email from Holly Foster Date:Tuesday, February 9, 2021 8:23:43 AM Attachments:02_09_21 Butte County Cattlemen_300 Feet Setback Butte County BOS Comments.docx 05_05_09 County Land Use Planning.pptx Good morning, Please see the public comment email and attachments submitted for 2/9/21 Item 5.03. Amy Schuman Associate Clerk of the Board ButteCountyAdministration 25CountyCenterDrive,Suite200,Oroville,CA95965 O:530.552.3300|D:530.552.3308|F:530.538.7120 Twitter|Facebook|YouTube|Pinterest From: Holly Foster <holly@robertfosterranch.com> Sent: Tuesday, February 9, 2021 7:27 AM To: Mendoza, Louie <LMendoza@buttecounty.net>; 'Colleen Cecil - Butte County Farm Bureau' <colleen@buttefarmbureau.com>; 'David A Daley' <DDaley@csuchico.edu> Subject: RE: Board of Supervisors Agenda ATTENTION: This message originated from outside Butte County. Please exercise judgment before opening .. attachments, clicking on links, or replying. Good Morning, I put together the attached memo. I’ve also attached talking points we had previously developed during the General Plan update. Some of this may be relevant to today’s discussion. I am unable to call in or attend the meeting remotely as I have other commitments. I will try to submit this via the public comment portal, unless Louie is able to bring it forward? Thank you, Holly R OBERT F OSTER R ANCH HollyFoster 530.570.0757|holly@robertfosterranch.com February 9, 2021 TO: Butte County Board of Supervisors FR: Holly Foster, President and Dave Daley, Secretary, Butte County Cattlemen’s Association RE: 5.03 1:00PM – Timed Item – Program Update on Exceptions to Agricultural Buffer Setbacks Pursuant to Butte County Code Section 24-84 of the Zoning Ordinance Our association spent considerable time in 2007 and 2008 providing comments in support of the Agriculture Buffer Ordinance. Agriculture is the primary economic driver for Butte County, and as such, any land use planning tools that are available should be utilized and enforced to promote an environment where our farming and ranching businesses can successfully operate. The buffer was established to reduce conflicts between rural residents and common and necessary farming practices. Rural residents that choose to build on lands adjacent to existing ag operations must recognize that farming practices are a necessary part of those businesses. Our association strongly discourages exceptions to the setback guidelines, and that if exceptions are being considered, they receive a strict review from the Butte County Ag Commissioner (Zoning Ordinance, Article 17, Section 24-84, Exceptions to Agricultural Buffer Setbacks). Our association’s position is consistent with that of the Butte County Farm Bureau. As the member organizations representing farming and ranching interests in Butte County, we appreciate your consideration of our comments as you review this policy. For more information, please feel free to contact either one of us. Holly Foster, President – (530) 570-0757, holly@robertfosterranch.com Dave Daley, Secretary – (530) 521-3826, ddaley@csuchico.edu A Cattleman’s Perspective County Land Use Planning generational operations 1 - owned, multi - Butte County Cattle Production Cattle production is an integral part of Butte County historyCattle and calves represent the county’s seventh most valuable commodity with a production value of $10,817,000FamilyDependent upon owned and leased rangeland Seasonal grazingOperate on very slim margins http://www.buttecounty.net/Agriculture%20Commissioner/~/media/County%20Files/Agriculture/Public%20In ••••••1 ternet/2007_Crop_Report.ashx Rangeland Values Like the view? Thank a cattleman.Privately owned rangeland is critical to maintaining open space, wildlife habitat and aesthetic valuesAquifer recharge zonesResearch has demonstrated grazing is beneficial to native plant speciesRangeland and pasture operations compatible with a multitude of uses and conservation goalsViable ranches provide local economic benefits, while maintaining open space •••••• 20 acre parcels with one - i.e. 10 — ” distant from existing spheres of influence ranchettes Leapfrog developmentConversion of rangeland to development in areas distant from existing spheres of influenceDiscourage development that propagates “homesite ––– Butte County General Plan 2030 Growth is inevitable. Let’s make it responsible.Ag ElementIn order for cattle ranching to remain viable in Butte County, General Plan 2030 must reflect policies that discourage: ••• to: 160 acres) - and grazing land ag ag include, but are not limited land and grazing Ordinance land for the sake of ag to Farm Maintain critical production zonesMaintain land affordability for ranchers Maintains tax revenue stream, while reducing development potential Ag Land Preservation Tools ••• Prime farm land Williamson ActAgricultural buffers Right Larger minimum zoning in grazing and farm land (e.g. 80Farm land mitigation/developer’s fees to offset farm and grazing land converted to residential or commercial developmentConservation easements to preserve ––––––– Preserving County supported initiatives may •• rence on land. te nfe , Berkeley, Calif. if. and fragementation . . . development increases human impact, causes scale ranches now face - ranchette . , many of the state’s large five percent of all federally threatened and endangered species have some habitat on - land. , L. and J.S. Fried. 1992. Resource management conflict at the urban fringe: The case of Mt. Diablo State Park. Abstracts, Co , S.G. Oaks at the edge: land use change in the woodlands of the central Sierra Nevada, California. Ph.D. Diss., Univ. of Cal , D., M. Bean, R. Bonnie, and M. McMillan. 1996. Rebuilding the ark: toward a more effective Endangered Species Act for priva Ninetyprivate land. In addition, virtually all of the water consumed by California residents flows over this Unfortunatelysubdivision. By dividing land into small parcels, habitat fragmentation and disrupts wildlife migrationA single property owner’s decision to subdivide can spell the fate for many thousands of acres. Neighboring ranches are often negatively impacted, and the resulting increased land values can diminish the remaining rancher’s ability to pass the land on to the next generation due to the threat of inheritance taxesToday, most California ranches are now less than five miles from a subdivision, and the average size of rangeland properties is shrinking Environmental Defense Fund, Washington D.C. Social Aspects and Recreation Research. U.S. Forest Service, Ontario, CA Food for Thought or Chewing the Cud ••••••ReferencesWilcoveJohnsonHuntsinger Board of Supervisors Meeting- Speaker Report Regular Meeting – February 9, 2021 Speaker: Mike Mann Item for Comment: 5.03 – Timed Item – Program Update on Exceptions to Agricultural Buffer Setback Pursuant to Butte County Code Section 24-84 of the Zoning Ordinance. Platform: Phone Speaker: Colleen Cecil Item for Comment: 5.03 – Timed Item – Program Update on Exceptions to Agricultural Buffer Setback Pursuant to Butte County Code Section 24-84 of the Zoning Ordinance. Platform: WebEx Clerk of the Board Andy Pickett Chief Administrative Officer and Clerk of the Board 25 County Center Drive, Suite 200 T: 530.552.3300 buttecounty.net/administration Oroville, California 95965 F: 530.538.7120 Members of the Board Bill Connelly | Debra Lucero | Tami Ritter | Tod Kimmelshue | Doug Teeter MEMORANDUM DATE: February 11, 2021 RE: Public Comment Submitted for February 9, 2021 Butte County Board of Supervisors Meeting Item 6 – Board of Supervisors Public Comment Pursuant to current State Public Health directives to shelter-in-place and practice social distancing due to the COVID19 pandemic, and as authorized by Governor Gavin Newsom’s Executive Orders N-25-20 and N-29-20, the meeting was closed to the public and all non-essential County staff. Members of the public were encouraged to participate remotely from a safe location by submitting comments electronically. Enclosed please find all public comment related to Item 6 at the February 9, 2021 Board of Supervisors Meeting. Amy Schuman Associate Clerk of the Board From:Schuman, Amy To:Alpert, Bruce;Bennett, Robin;Clerk of the Board;Connelly, Bill;Cook, Holly;Cook, Robin;Kimmelshue, Tod; Lucero, Debra;Paulsen, Shaina;Pickett, Andy;Ring, Brian;Ritter, Tami;Rodas, Amalia;Sweeney, Kathleen; Teeter, Doug Cc:Taylor, Donnell (Don);Boston, Shelby;Kim, Sang;Honea, Kory;Hatcher, Casey Subject:Public Comment 2/9/21 Item 6 - Email from Cathy Wagner RE COVID Risk and Human Rights Abuse Date:Friday, February 5, 2021 1:25:15 PM Good afternoon, Please see the public comment below submitted by Cathy Wagner for the 2/9/21 Board of Supervisors Meeting, Item 6 – General Public Comment. Amy Schuman Associate Clerk of the Board Butte County Administration 25 County Center Drive, Suite 200, Oroville, CA 95965 O: 530.552.3300 |D: 530.552.3308 | F: 530.538.7120 Twitter | Facebook | YouTube | Pinterest From: Cathy Wagner <cathy_wagner@comcast.net> Sent: Friday, February 5, 2021 12:52 PM To: Clerk of the Board <clerkoftheboard@buttecounty.net> Subject: For Item 6: COVID Risk and Human Rights Abuse ATTENTION: This message originated from outside Butte County. Please exercise judgment before opening .. attachments, clicking on links, or replying. I am shocked, sickened, and outraged at the way the homeless population of Chico CA is being treated. Furthermore, I believe that the Chico City Council, Chico Mayor, and Chico Police are endangering all of us by going against CDC guidelines regarding homeless encampments. On January 10, homeless citizens camping in the public park were given 72 hour eviction notices with no where else to go. All of our shelters are full and there are no designated areas where it's "legal" to be homeless. On January 13, the tents and belongings of over 60 people were literally bulldozed. Displaced homeless people were told, "We don't know where to tell you to go, but you can't stay here." And now it's has happened again. On February 4, homeless Californians were removed from a strip of land in the middle of what is essentially a divided roadway. Again, they were not given any option where to go. In fact, Kami Denlay of the Chico City Council was quoted as saying she “couldn't understand why there was a discussion of using general funds \[to support solutions\] for homelessness when they could be spent to retrofit the council chambers” at a City Council meeting on February 2. According to the city, people can sleep on the sidewalk or public right of way, but must leave room for handicapped access, and cannot pitch a tent. They are allowed to have the things "necessary to sustain life," on the sidewalk with them, which are a sleeping bag and a pillow. They are not allowed to sleep under the awning at the municipal building, or under awnings or entryways downtown. It can't be legal to treat people, Americans, like this! We obviously need someone with a higher authority to step in. Please do something to stop this inhumanity that is happening right now in the middle of winter amid a pandemic. We have people freezing on the streets with no where to go! CathyWagner 700SalemSt.Apt205 ChicoCa95928 ConstituentinCA-01 cc:GovernorGavinNewsom From:Sascha Anya To:Schuman, Amy Subject:Fw: Comments For Board of Supervisors 2/10/2021 Date:Tuesday, February 9, 2021 10:49:33 AM Attachments:Dr.-Lee-File-Stamped SARS-CoV-2 PCR Test Appeal 23pg.pdf Public Comment Item 6. Comment BOS meeting 2-9-2021 Sascha Sarnoff_Clerk.pdf ATTENTION: This message originated from outside Butte County. Please exercise judgment before opening .. attachments, clicking on links, or replying. Sascha Sarnoff, Advocate Chico Environmental Health Advocacy ________________________________ (805) 500-6820qwave@protonmail.com ------- Original Message ------- On Tuesday, February 9, 2021 9:00 AM, Sascha Anya <qwave@protonmail.com> wrote: Dear Clerk of the Board, Agenda Item 6. Public Comment BOS meeting 2/9/2021 Please forward my letter addressed to Butte County Counsel, County Board of Supervisors, and County Public Health. Additionally please put a copy of this letter, along with any links and attachments into the public record. Thanks! Sascha Sarnoff, Advocate Chico Environmental Health Advocacy ________________________________ (805) 500-6820qwave@protonmail.com Dear Clerk of the Board, Please forward the attached letter to Butte County Counsel, Butte County Board of Supervisors, and Butte County Public Health. Additionally, please place a copy of my email along with all attachments to the public record. Thank you for your kind assistance. Item 6. Item Board of Supervisors Public Comment | 2/9/2021 URGENT Request for New Motion From Board of Supervisor (BOS): Pause all new SARS-CoV-2 case-counts. Unless the County can validate and prove that RT-PCR testing for SARS-CoV-2 is a proven and accurate method to determine live, active infection the county should not be allowed to include any positive test results in the tier assessments or other analytics. Concern: Butte County Public Health misrepresenting and/or misleading the public and BOS Lawsuit declaration submitted: Dr. Lee Declaration (23 pages Attached) Motion Request: Urgent review required regarding the Butte County Public Health Department use of RT-PCR tests for counting Butte County cases of SARS-CoV-2 (and any other infections not able to be determined by these tests). As of the last two weeks, local medical labs have confirmed that nasal swap RT-PCR test results being are still produced with amplification set at 42 & 45 Ct. (cycle threshold). There no reason on earth for Butte County Public Health (BCPH) to accept any tests such as this. The test results at this amplification are entirely meaningless. Why is BOS allowing reckless testing as the basis for case-counts? Case-counts establish lock-down tiers and this amounts to intentionally misleading the public which is a fraud. I believe that BCPH is concealing the known number of infections by inflating case numbers using RT- PCR testing scheme. which in turn is causing great harm. This harm is systematically destroying please initiate a motion to re-evaluate the current system of rampant misidentification RT-PCR-based case-counts. Not a single more cases should be added to the county- wide count until a thorough scientific investigation can be made to evaluate these claims. BOS must issue a motion to BCPH to immediately halt any further RT-PCR-based case-counts BOS and staff have been notified about these siuations over the past year and yet testing remains an ongoing county problem. on numerous occasions and the staff has been made aware of this situation from the public detailing that RT-PCR tests results for SARS-CoV-2 are erroneous and fraudulent in the way they are being used. County Counsel specifically has been made aware of the misleading SARS- CoV-2 test results as data establishing lock-down tiers and the upcoming plan to set-up a county laboratory specifically for RT-PCR testing; despite scientific evidence, and product test-kit disclaimers that acknowledge the tests as inaccurate for determining active, live infections. BOS must act now. Issues Identified: 1. Laboratory Test Equipment is incapable of determining or detecting live infection/infectiousness. However, detecting live infection is the stated purpose of Butte County Public Health efforts to begin in-house county testing of the public. 2. Uninformed consent. 3. Disseminating misinformation/disinformation that is misleading BOS and the public. 4. Misappropriation of SARS-CoV-2 test result data. 5. RT-PCR is unfit-for-purpose. This nothing more than an erroneous method of testing the general public who are wholly unaware of the significant limitations of RT-PCR to determine active infection (these limitations are ignored by BCPH yet they are claimed by test-kit manufacturers for many decades.) 6. Requesting in-house RT-PCR lab equipment to conduct more fraudulent testing than is already underway, is more evidence BCPH is ignorant of the facts or just ignoring them. 7. Arbitrary and capriciously high Cycle-threshold amplification assignment without evidence of accuracy. 8. Meaningless RT-PCR test results are leading to potential lawsuits for years to come. 9. Arbitrary and inaccurate test results are already being used to manipulate the entire county and modify public behavior. Using RT-PCR for determining SARS-CoV-2 infection is highly deceptive and would likely be considered criminal when overwhelming evidence is presented. 10. Abusing the public trust. Erosion of public confidence in Butte County Public Health and BOS will have lasting consequences. When the public finds out about the totality of this very specific deceptive scheme there may be an uproar the like of which we can only imagine. 11. Misappropriating inaccurate RT-PCR test result data as a pretext for the continued and unsupported tier-based restrictions currently inflicting untold harm upon the unsuspecting public. 12. BCPH is abusing its power by knowingly engaging in a fraudulent scheme that misappropriates test results to inflate the case numbers. 13. BCPH operates under the pretense of preventing the spread of infectious disease and protecting public health, while in fact, BCPH is causing irreparable harm resulting in millions of dollars of damages. Butte County Public Health puts the entire county in an untenable position. 14. RT-PCR test results are fabricated through exponentially high amplification cycles which laboratory professionals and industry experts are well aware of. Thus, the people of Butte County have been completely misled and have suffered economic and social distress and damages because Butte County is incorrectly using and interpreting false data, thus misinforming the public that a COVID- 19 emergency exists in Butte County. NYC Lawsuit | Declaration of Yale researcher and professor Dr. Lee \[23 page declaration by Dr. Lee - PDF attached\] Excerpt: receive patient samples for further validation testing. I re-tested 20 reference patient samples supplied by the Connecticut Department of Public Health on April 30, 2020, and found that 3 of 10 reference samples initially classified as positive for SARS-CoV-2 by RT-qPCR test were false positives and 2 of 10 reference samples initially classified as negative were found to contain SARS-CoV-2 proven by DNA sequencing. These results were reported to the Connecticut Department of Public Health and published on July 17, 2020. Four days later on July 21, 2020, the Connecticut Department of Public Health also reported that a total of 90 out of 144 people tested between June 15 and July 17, many of whom were nursing home residents, received false-positive SARS-CoV-2 RT-qPCR test results because of a flaw in the test used at COVID-19 tests were false: report, NEW YORK POST (Jul. 21, 2020), https://nypost.com/2020/07/21/connecticut-testing-lab-botches-dozens-of-coronavirus-tests/. Attached as Exhibit 3 is a true and correct link to that article. 10. There is ample evidence that the currently used RT-qPCR tests are inaccurate for -CoV-2, the virus causing COVID-19. The inherent flaw of PCR for the detection of SARS-CoV- Sincerely, Sascha Sarnoff, Advocate Chico Environmental Health Advocacy ________________________________ (805) 500-6820 qwave@protonmail.com Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!2!pg!34 UNITED STATES DISTRICT COURT SOUTHERN DISTRICT OF NEW YORK ADRIANA AVILES, Individually and as Parent and Natural Guardian of N.A., N.A. and A.A., STEPHANIE DENARO, Individually and as Parent and Natural Guardian of D.D. and H.D., CHRISTINE KALIKAZAROS, Individually and as Parent and Natural Guardian of Y.K., GAETANO LA MAZZA, Individually and as Parent and Natural Guardian of R.L., CRYSTAL LIA, Individually and as Parent and Natural Guardian of F.L., and HEALTH DEFENSE, DECLARATION OF SIN HANG Plaintiffs, LEE, MD Against Civil No.: BILL de BLASIO of the City of New York, DR. DAVID CHOKSHI, in City of New York, NEW YORK CITY DEPARTMENT OF EDUCATION, RICHARD A. CARRANZA the New York City Department of Education and THE CITY OF NEW YORK, Defendants. I, Sin Hang Lee, MD declare as follows: 1. I am a pathologist and research scientist based in Connecticut who has been developing DNA sequencing-based molecular tests to diagnose infectious diseases that are difficult to diagnose, such as Lyme disease and human papilloma virus (HPV) infection. 2. has published scores of scientific articles in peer-reviewed journals. 3. Exhibit 1 is a true and accurate copy of my current CV. 1 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!3!pg!34 4. It is my professional opinion that the need for accurate coronavirus testing is imperative. It is especially critical in nursing homes and institutions caring for elderly patients, so that false-positive patients are not housed with true- ensure that staff in direct contact with highly susceptible patients be infection-free. 5. I have been working diligently to overcome the roadblocks in coronavirus testing. 6. As early as March 2020, I wrote to the WHO and to Dr. Anthony Fauci at the National Institute of Allergies and Infectious Diseases of the National Institutes of Health (NIH) to explain why the current tests to detect SARS-CoV-2 RNA are generating false positives and negatives. The letter explained that a two- no- correct copy of that letter is attached as Exhibit 2. The method I used was subsequently published in a peer-reviewed international journal based in Japan. 7. It is my opinion, one supported by the FDA, that questionable or false RT-qPCR test results can be investigated and resolved by Sanger sequencing, the testing method I developed. 8. Given the specificity of my letter, with its DNA sequencing electropherograms and its significance for preventing disease spread, it is almost unbelievable that as of the date of this declaration, I have received no response from either the WHO or NIH. 9. In April 2020, I reached out to the Connecticut Department of Public Health to receive patient samples for further validation testing. I re-tested 20 reference patient samples supplied by the Connecticut Department of Public Health on April 30, 2020, and found that 3 of 10 reference samples initially classified as positive for SARS-CoV-2 by RT-qPCR test were false positives and 2 of 10 reference samples initially classified as negative were found to 2 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!4!pg!34 contain SARS-CoV-2 proven by DNA sequencing. These results were reported to the Connecticut Department of Public Health and published on July 17, 2020. Four days later on July 21, 2020, the Connecticut Department of Public Health also reported that a total of 90 out of 144 people tested between June 15 and July 17, many of whom were nursing home residents, received false-positive SARS-CoV-2 RT-qPCR test results because of a flaw in the test used at Gabrielle Fonrouge, Connecticut lab finds 90 positive COVID-19 tests were false: report, N EW Y ORK P OST (Jul. 21, 2020), https://nypost.com/2020/07/21/connecticut-testing-lab-botches-dozens-of-coronavirus-tests/. Attached as Exhibit 3 is a true and correct link to that article. 10. There is ample evidence that the currently used RT-qPCR tests are inaccurate for determining if a -CoV-2, the virus causing COVID-19. The inherent flaw of PCR for the detection of SARS-CoV-2 RNA is further discussed as follows. 11. PCR (polymerase chain reaction) is a chemical reaction used to duplicate a defined segment of DNA exponentially in the test tube. To detect or to analyze a segment of target DNA molecule in question is usually by DNA sequencing, the process of determining the orders of the nucleotides (As, Ts, Cs, and Gs), which link up as a chain in the target DNA molecule. 12. However, the current technology cannot analyze one or a few DNA molecules in the sample being tested. These DNA molecules must be amplified, or made larger in number by a duplicating process to reach a mass of identical molecules to be analyzed. This amplification process, commonly referred to as PCR, is what Kary Mullis discovered, and consists of multiplying sequentially and exponentially by doubling the target DNA segment present in a test tube. So, 2 becomes 4, then becomes 8, then 16, and so forth, using newly formed copies as the 3 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!5!pg!34 templates to make more new copies of the same molecule continuously. In such a duplication manner, each molecule of DNA in the original sample can become more than 1 billion copies after 30 cycles of amplification, in theory. 13. As noted, PCR multiplies DNA. But the genetic material that comprises the genome of SARS-CoV-2, the virus causing COVID-19, is RNA that is much more labile or unstable than DNA. It must be converted to DNA in order to utilize the PCR process. This is accomplished by action of an enzyme called reverse transcriptase (RT) in the first of four steps involved in the process. RT thus allows a single strand of RNA to be reverse-transcribed into a complementary strand of DNA, cDNA in short. The process of RT acting on RNA, leading to cDNA amplification through PCR, is called RT-PCR, which should be distinguished from RT- qPCR or rRT-PCR, the method currently being used for SARS-CoV-2 PCR testing. 14. The principle of PCR is based on primer-initiated and template-directed enzymatic polymerization of nucleotides. That means that there must be a segment of single- stranded DNA (ssDNA) serving as the template to direct the nucleotide incorporation for the synthesis of the new ssDNA whose sequence is complementary to the template. It also means that the synthesis of the new ssDNA must start with a primer, which is an oligonucleotide of about 20 nucleotides long and complementary to a segment of the target template DNA, annealing to (attached to) the target DNA at one of the two beginning sites of the target DNA to be amplified. Without a primer, the enzyme, DNA polymerase, will not work. In other words, PCR begins with enzymatic primer extension. The enzyme, a DNA polymerase, works like a type writer adding t 4 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!6!pg!34 15.The primer/template annealing process of PCR is based on DNA/DNA hybridization by forming hydrogen bonds between all complementary base pairs of the primer and template. However, DNA/DNA hybridization or annealing can take place even if there is only a partial match in base pairs between a primer and an unintended DNA in the PCR mixture in the absence of a fully matched target DNA template. Under certain circumstances the DNA polymerase can amplify an unintended (undesirable) DNA with a pair of partially matching primers and generate unintended (undesirable) PCR products. If the PCR products are not further analyzed for confirmation, false-positive test results may be produced. 16.The endpoint of an RT-qPCR test is arbitrarily set by the test kit manufacturer, of this sim incomprehensible. 17.I agree with Dr. Michael Mina, assistant professor of epidemiology at the Harvard T. H. Chan School of Public Health, who is quoted in the New York Post article as saying that the following discussion of the amplification process, sometimes also referred to as cycles. Dr. Mina is quoted in the Harvard Magazine (8/3/20) as saying that Current PCR testing detects virus genome- the results are virtually useless for public health efforts to contain the raging epidemic 5 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!7!pg!34 18. Tests with thresholds so high may detect not only live virus, but also simple genetic fragments, leftover from past infection that poses no risk for current exposure to others, or from other unrelated nucleic acids in the sample. 19. I agree with virologist Dr. Juliet Morrison that any test with a cycle threshold above 35 is too sensitive (in other words will read positive when the individual is not infectious). 20. I am of the opinion that it would be quite easy and simple to manipulate the number of positive results with this form of testing by the test kit manufacturers to please their customers whose business benefits from a high number of COVID-19 cases. 21. I believe that with varying numbers of cycles or amplifications being used in different states or even in different health systems in one state, it would be quite easy and simple to manipulate the number of positive results with this form of testing by simply changing the number of cycles to a higher number to produce the appearance of worsening or to a lower one to produce lower infection numbers. I agree with some experts who say that if over 40 amplifications be used, 100% of people tested might turn out to be positive. 22. I believe that the currently used RT-qPCR is a faulty diagnostic test, For example, an individual who gets a positive test result in a facility or area that is using a test setting the cutoff at 37 cycles might fly to another area where repeat testing is using a cutoff at 30 cycles - location one does not have it after flying to the second location. 23. This reveals the absurdity of the RT-qPCR based test. 24. To have children to take such an unreliable test is equally absurd. 6 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!8!pg!34 I declare under penalty of perjury under the laws of the United States of America that the foregoing is true and correct. th Executed this 15 day of December, 2020 in Milford, Connecticut. Signed ___________________________________ Sin Hang Lee, MD 7 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!9!pg!34 EXHIBIT 1 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!:!pg!34 CURRICULUM VITAE NAME: SIN HANG LEE, M.D., F.R.C.P. (C), F.C.A.P. OFFICE ADDRESS: Milford Molecular Diagnostics Laboratory 2044 Bridgeport Avenue, Milford, CT 06460 PLACE OF BIRTH: HONG KONG CITZENSHIP: NATURALIZED U.S. CITIZEN 1976 EDUCATION Tongji University College of Medicine and Wuhan Medical College (combined since 1952) Shanghai and Hankow, Hubei, China 1951-56 HIGH PROFESSIONAL DEGREE F.R.C.P. (C) Royal College of Physicians and Surgeons of Canada 1966 POSTGRADUATE TRAINING and EXPERIENCE Teaching assistant in microbiology, Sichuan Medical College and Guiyang Medical College, China 1956-61 Demonstrator in pathology, University of Hong Kong, School of Medicine, Hong Kong 1961-63 Rotating clinical intern, South Baltimore General Hospital, Baltimore, MD 1963-64 Resident, Assistant Pathologist and Pathologist at New York Hospital, Cornell Medical Center, New York, NY 1964-67 Pathology Fellow at Memorial Hospital for Cancer and Allied Diseases, New York, NY 1967-68 Assistant Professor of Pathology, McGill University, Montreal, Canada 1968-71 Associate Professor of Pathology, Yale University, New Haven, CT 1971-73 1 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!21!pg!34 Attending Pathologist at Hospital of St.Raphael and Associate Clinical Professor of Pathology, Yale University, New Haven, CT 1973-2003 Pathologist at Milford Hospital, Milford, CT 2004- 2015 Director, Milford Medical Laboratory, Inc. Milford, CT 2008- 2015 Director, Milford Medical Laboratory Molecular Diagnostic Section 2008- 2015 Director, Milford Molecular Diagnostics Laboratory 2015- MEDICAL LICENSURE: District of Columbia, New York and Connecticut (current), U.S.A. Licentiate of the Medical Council of Canada Certificate of full registration, General Medical Council, London, Great Britain SPECIALTY BOARDS: Diplomate, American Board of Pathology (AP) 1966 Certificated Specialist in General Pathology (AP and CP) Canada 1966 Expertise: General pathology, surgical pathology, clinical microbiology, and molecular diagnostics by PCR/direct DNA sequencing. PUBLICATIONS: 1. Lee, S.H. Properdin (in Chinese) Chinese Med J. 8:796-799. 1958. 2. -und -J. Otte and W. Köhler Veb Gustav Fischer Verlag-Jena. 1958, Peoples Hygiene Publisher, Beijing, China, 1961. 3. 17:37-40, 1963. 4. Lee, S.H. Histochemical demonstration of glutamic oxalacetic transaminase. Amer. J. Clin. Path. 49: 568-572. 1968. 5. Lee, S.H. and Torack, R.M. Aldehyde as fixative for histochemical study of glutamic oxalacetic transaminase. Histochem. 12: 341-344, 1968. 6. Lee, S.H. and Torack, R.M. The effects of lead and fixatives of glutamic oxalacetic transaminase. J. Histochem. 16: 181-184, 1968. 7. Lee, S.H. and Torack, R.M. Electron microscope studies of glutamic oxalacetic transaminase in rat liver cell. J. Cell Biol. 39: 716-724. 1968. 2 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!22!pg!34 8. Lee, S.H. and Torack, R.M. A biochemical and histochemical study of glutamic oxalacetic transaminase activity of rat hepatic mitochondria fixed in situ and in vitro. J. Cell Biol. 39: 716-724. 1968. 9. Lee, S.H. Ultrastructural localization of glutamic oxalacetic transaminase activity in cardiac muscle fiber and cardiac mitochondrial fraction of the rat. Histochem. 19: 99-109. 1969. 10. Lee, S.H. The possible role of the vesicles in renal ammonia excretion. J. Cell Biol. 45: 644-649. 1970. 11. Lee, S.H. Cytochemical study of in vivo inhibition of hepatic glutamic oxalacetic transaminase by hydrazine. Beitr. Path. 141: 99-106. 1970 12. Lee, S.H. and Aleyassine, H. Hydrazine toxicity in pregnant rats. Arch. Environ. Health 21: 615-619. 1970. 13. Chak, S.P. and Lee, S.H. Ultrastructural localization of glutamic oxaloacetic transaminase activity in adrenal cortical cell of rat. J. Ultrastructure Res. 35: 265-273. 1971. 14. Lee, S.H. and Aleyassine, H. Morphologic changes in the liver of mice bearing Ehrlich ascites tumor: Lab. Invest. 24: 513-522. 1971. 15. Aleyassine, H. and Lee, S.H. Inhibition by hydrazine, phenelzine and pargyline of insulin release from rat pancreas. Endocrinol. 89: 125-129. 1971 16. Lee, S.H., Dusek, J. and Rona, G. Electron microscopic cytochemical study of glutamic oxalacetic transaminase activity in ischemic myocardium. J. Mol. Cell. Cardiol. 3: 103-109. 1971. 17. Aleyassine, H. and Lee, S.H. Inhibition of insulin release by substrates and inhibitors of monoamine oxidase. Amer. J. Physiol. 222: 565-569. 1972. 18. Lee, S.H. Isolation of parietal cells from glutaraldehyde-fixed rabbit stomach. J. Histochem. Cytochem. 20: 634-643. 1972. 19. Hayat, ed.). VoL. I. pp.116-130. Van Nostrand Reinhold Co., New York. 1973. 20. Lee, S.H. Ultracytochemistry of the mitochondrial glutamate oxalacetate transaminase th activity. pp. 107-108. Proc. 4 Internatl. Congr. Histochem., Kyoto, Japan. 1972. 21. Schachter, E.N., smith, G.J.W., Cohen, G.S., Lee, S.H., Lasser, A. and Gee, J.B.L. Pulmonary granulomas in a patient with pulmonary veno-occlusive disease. Chest 67: 487-489. 1975. 3 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!23!pg!34 22. Lee, S.H. Estrogen binding of human breast cancer cells studied with a fluorescent estradiol conjugate. Fed. Proc. 37:462. 1978 (abstr.) 23. Lee, S.H. Cytochemical study of estrogen receptor in human breast cancer. Amer. J. Clin. Path. 70: 197-203. 1978. 24. Lee, S.H. Determination of breast cancer cell estrogen receptor in frozen sections. Lab. Invest. 40:268. 1979 (Abstr.) 25. Lee, S.H. Simultaneous detection of estrogen and progesterone receptors in breast cancer cells. Fed. Proc. 38:913. 1979 (Abstr.) 26. Lee, S.H. Cancer cell estrogen receptor of human mammary carcinoma. Cancer 44:1-12. 1979. 27. Lee, S.H. Cellular estrogen and progesterone receptors in mammary carcinoma. Amer. J. Clin. Path. 73:323-329. 1980. 28. Lee, S.H. Hydrophilic macromolecules of steroid derivatives for the detection of cancer cell receptors. Cancer 46:2825-2828. 1980. 29. Lee, S.H. Estrogen and progesterone receptors in breast cancer A new approach to measure. Connecticut Med. 44:622-625. 1980. 30. Lee, S.H. Sex-steroid hormone receptors on mammary carcinoma. In Masson Monographs in Diagnostic Pathology. Diagnostic Immunohistochemistry. Ed. R. A. DeLellis. pp.149-164. Masson Publishing USA, Inc., New York. 31. Lee, S.H. The histochemistry of estrogen receptors. Histochem. 71:491-500. 1981. 32. Lee, S.H. Histochemical estrogen receptor assay. Amer. J. Clin. Path. 76:365. 1981 33. Lee, S.H. Prospects for histochemical assay of steroid receptors In Endocrine Relationships in Breast Cancer. Ed. B. A. Stoll. pp.144-155. 1982 William Heinemann Medical Books LTD, London 34. Lee, S.H. Estrogen receptor-rich neuroglia of the rat brain. Lab. Invest. 46:49A 1982 (Abstr.) 35. Lee, S.H. Uterine epithelial and eosinophil estrogen receptors in rats during estrous cycle. Histochem. 74:443-452. 1982. 36. Lee, S.H. Estrogen-primed immature rat uterus a tissue control for histochemical receptor assay. Amer. J. Clin. Path. 79:484-486. 1983. 4 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!24!pg!34 37. Lee, S.H. Augmentation and depletion of cytoplasmic estrogen-binding sites as visualized by histochemical technique. J. Steroid Biochem. 19:31S. 1983 (Abstr.) 38. Lee, S.H. Validity of a histochemical estrogen receptor assay. Supported by the observation of a cellular response to steroid manipulation. J. Histochem. Cytochem. 32:305-310. 1984. 39. Benz, C., Wiznitzer, I. and Lee, S.H. Flow cytometric analysis of fluorescein-conjugated estradiol (E-BSA-FITC) binding in breast cancer suspensions. Cytometry 6:260-267. 1985. 40. Lee, S.H. Histochemical study of estrogen receptors in the rat uterus with a hydrophilic fluorescent estradiol conjugate. Localization of Putative Steroid Receptors. Vol. I. Eds. L.P. Pertschuk and S.H. Lee. CRC Press, Inc., Boca Raton, USA pp 59-83. 1985. 41. Lee, C., Jesik, J., Mangkornkanok, M., Sensibar,J. and Lee, S.H. Estrogen receptors and hormone responsiveness in serially transplanted mammary tumors in rats. Localization of putative Steroid Receptors. Vol. I Eds. L.P. Pertschuk and S.H. Lee. CRC Press, Inc. Boca Raton, USA, pp 85- 42. Benz, C., Wiznitzer, I. and Lee, S.H. Flow cytometric analysis of fluorescent estrogen binding in cancer call suspensions. Localization of Putative Steroid Receptors. Vol. I Eds. L.P. Pertschuk and S.H. Lee, CRC Press, Inc. Boca Raton, USA. pp.95-110. 1985. 43. Lee, S.H. A fluorescent histochemical study of steroid receptors in human breast cancer. Localization of Putative Steroid Receptors. Vol. II Eds. L.P. Pertschuk and S.H. Lee. CRC Press, Inc. Boca Raton, USA pp. 37-50. 1985. 44. Lee, S.H., Charoenying, S., Brennan, T., Markowski, M. and Mayo, D.R. Comparative studies of three serologic methods for the measurement of Mycoplasma pneumoniae antibodies. Amer. J. Clin. Pathol. 92:342-347. 1989. 45. Lee, S.H. Coexistence of cytoplasmic and nuclear estrogen receptors. A histochemical study in human mammary cancer and rabbit uterus. Cancer 64:1461-1466. 1989. 46. Keefe, D.L., Michelson, D.S., Lee, S.H. AND Naftolin, F. Astrocytes within the hypothalamic arcuate nucleus contain estrogen-sensitive peroxidase, bind fluorescein-conjugated estradiol and may mediate synaptic plasticity in the rat.Amer. J. Obstet. Gynecol. 1991; 164:959-966. 47. Rao SK, Caride VJ;, Ponn R, Giakovis E, Lee H. F-18 fluorodeoxyglucose positron emission tomography-positive benign adrenal cortical adenoma: imaging features and pathologic correlation. Clinical nuclear medicine 2004;29:300-2. 48. Lee SH. Green tea consumption and mortality in Japan. JAMA 2007;297(4):360. 49. Lee SH. Expanded use of human papillomavirus testing in gynecologic practice. Amer J Clin Path. 2007;128(5):883-4. 5 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!25!pg!34 50. Lee, S. H., Vigliotti, V.S., Vigliotti, J.S. and Pappu, S. Routine human papillomavirus genotyping by DNA sequencing in community hospital laboratories. Infect Agent Cancer 2007; 2:11. 51. Lee, S. H., Vigliotti, V.S., and Pappu, S. DNA Sequencing Validation of Chlamydia trachomatis and Neisseria gonorrhoeae Nucleic Acid Tests. Am J Clin Pathol. 2008;129:852-859. 52. Lee S.H., Vigliotti V.S., Pappu S. Human papillomavirus (HPV) infection among women in a representative rural and suburban population of the United States. Inter J Gyn Ob. 2009; 105:210- 214. 53. Lee, S.H., Vigliotti, V.S., and Pappu, S. Molecular tests for human papillomavirus (HPV), Chlamydia trachomatis and Neisseria gonorrhoeae in liquid-based cytology specimen. BMC 2009; 9:8. 54. Lee, S. H., Vigliotti, V.S., Vigliotti, J.S. and Pappu, S. Validation of human papillomavirus genotyping by signature DNA sequence analysis. BMC Clin Pathol 2009; 9:3. 55. Lee SH. HPV test is a virology test, not for predicting cancer. In Castle PE. The evolving definition of carcinogenic human papillomavirus Infect Agent Cancer 2009, 4:7. 56. Lee, S.H., Vigliotti, V.S., and Pappu, S. Signature sequence validation of human papillomavirus type 16 (HPV-16) in clinical specimens. J Clin Path. 2010;63:235-239. 57. Lee SH. HPV DNA test utilization.Am J Clin Path 2010;133(2):339. 58. Lee, S. H., Vigliotti, V.S., Vigliotti, J.S., Jones W. and Pappu, S. Increased Sensitivity and Specificity of Borrelia burgdorferi 16S Ribosomal DNA Detection. Am J Clin Path. 2010; 133:569-576. 59. Lee SH. From human papillomavirus to cervical cancer. Obstet Gynecol 2010; 116:1221-1222. 60. Lee, S. H., Vigliotti, V.S., Vigliotti, J.S., Jones, W., Williams, J., Walshon, J. Early Lyme disease with spirochetemia diagnosed by DNA sequencing. BMC Res Notes. 2010 Nov 1; 3:273. 61. Lee SH, Castle PE, Stoler M, Kinney W. Patient Safety and the Next Generation of HPV DNA Tests. Am J Clin Pathol. 2011 Mar;135(3):481. 62. Lee SH: Guidelines for the use of molecular tests for the detection and genotyping of human papilloma virus from clinical specimens. Methods Mol Biol 2012; 903:65-101. 63. Lee SH. Detection of human papillomavirus (HPV) L1 gene DNA possibly bound to particulate aluminum adjuvant in the HPV vaccine Gardasil®. J Inorg Biochem 2012; 117:8592. 6 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!26!pg!34 64. Lee SH. Detection of human papillomavirus L1 gene DNA fragments in postmortem blood and spleen after Gardasil® vaccination-A case report. Advances in Bioscience and Biotechnology 2012; 3: 1214-1224. 65. Lee SH. Topological conformational changes of human papillomavirus (HPV) DNA bound to an insoluble aluminum salt a study by low temperature PCR. Advances in Biological Chemistry 2013; 3: 76-85. 66. Hong G, Lee SH, Ge S, Zhou S. A Novel Low Temperature PCR Assured High-Fidelity DNA Amplification. International Journal of Molecular Sciences. 2013; 14:12853-12862. 67. Lee SH. Melting profiles may affect detection of residual HPV L1 gene DNA fragments in Gardasil®. Curr Med Chem. 2014; 21:932-940. 68. Lee SH, Vigliotti JS, Vigliotti VS, Jones W, Shearer DM. Detection of Borreliae in Archived Sera from Patients with Clinically Suspect Lyme Disease. International Journal of Molecular Sciences. 2014; 15:4284-4298. 69. Lee SH, Vigliotti JS, Vigliotti VS, Jones W, Moorcroft TA, Lantsman K. DNA Sequencing Diagnosis of Off-Season Spirochetemia with Low Bacterial Density in Borrelia burgdorferi and Borrelia miyamotoi Infections. International Journal of Molecular Sciences. 2014; 15:11364- 11386. 70. Lee SH, Vigliotti JS, Vigliotti VS, Jones W. From human papillomavirus (HPV) detection to cervical cancer prevention in clinical practice. Cancers (Basel). 2014; 6(4):2072-2099. 71. Lee SH, Zhou S, Zhou T, Hong G. Sanger Sequencing for BRCA1 c.68_69del, BRCA1 c.5266dup and BRCA2 c.5946del Mutation Screen on Pap Smear Cytology Samples. International Journal of Molecular Sciences. 2016; 17(2):229. 72. Lee SH. Lyme disease caused by Borrelia burgdorferi with two homeologous 16S rRNA genes: a case report. International Medical Case Reports Journal. 2016; 9:101106. 73. Lambert JS, Cook MJ, Healy JE, Murtagh R, Avramovic G, Lee SH. Metagenomic 16S rRNA gene sequencing survey of Borrelia species in Irish samples of Ixodes ricinus ticks. PLoS One. 2019;14:e0209881. 74. Lee SH, Healy JE, Lambert JS. Single Core Genome Sequencing for Detection of both Borrelia burgdorferi Sensu Lato and Relapsing Fever Borrelia Species. Int J Environ Res Public Health. 2019;16: E1779. 75. Lee S.H. Testing for SARS-CoV-2 in cellular components by routine nested RT-PCR followed by DNA sequencing. International Journal of Geriatrics and Rehabilitation. 2020; 2::69- 96. 7 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!27!pg!34 EXHIBIT 2 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!28!pg!34 Sin Hang Lee, MD, F.R.C.P.(C) Milford Molecular Diagnostics Laboratory 2044 Bridgeport Avenue Milford, CT 06460 USA March 22, 2020 Dr. Margaret Harris The World Health Organization's coronavirus response team harrism@who.int Dr Eduardo Guerrero WHO Regional Office for the Americas guerrere@paho.org Dr. Anthony S Fauci af10r@nih.gov Extremely sensitive, no false-positive tests needed for SARS-CoV-2 Dear Drs. Harris, Guerrero and Fauci: It has been widely reported in the social media that the RT-qPCR test kits used to detect SARS- CoV-2 RNA in human specimens are generating many false positive results and are not sensitive enough to detect some real positive cases, especially during convalescence. RT-qPCR is known to generate false positive results when used to detect influenza A virus \[1\] and MERS-CoV, \[2\] another Coronavirus. Without a nested (two-round) PCR, a single round RT-PCR may miss real infections caused by SARS-CoV \[3\] and by SARS-CoV-2 \[4\]. The major technical flaw of RT-qPCR for molecular diagnosis is the limitation of the length of its DNA probe which is about 25 bases long or shorter. And hybridization is not an accurate method to determine nucleotide sequences, the foundation of all nucleic acid-based diagnostics. This letter recommends that the WHO coronavirus response team adopt or develop a nested RT- qPCR protocol to generate a cDNA PCR amplicon to be used as the template for bi-directional sequencing. As demonstrated in this letter, nested RT-PCR is an extremely sensitive detection method and DNA sequencing will guarantee no-false positive results if all positive reports are accompanied by two-directional sequencing electropherograms, like an EKG for the diagnosis of Left Bundle Branch Block consultation. Based on information retrieved from the GenBank databases and available in the public domain, there is a unique 398-base segment in the SARS-CoV-2 nucleocapsid (N) gene which not only has a 100% match with that in the Wuhan seafood market pneumonia virus, but also contains four single-nucleotide mutations found in the viruses isolated from patients in the states of Њ Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!29!pg!34 California, Texas and Massachusetts of the U.S.A. This segment of the gene can be targeted for accurate molecular diagnosis. The nucleotide sequence of this 398-base gene segment is copied from the GenBank and re- printed here with the 4 mutated bases typed in red color. Identification of these virus isolates each with a single-base mutation in this segment may be useful in tracing the immediate source of the pathogen among patients and carriers tested positive for SARS-CoV-2. Tfwfsf!bdvuf!sftqjsbupsz!tzoespnf!dpspobwjsvt!3!TBST.DpW.3!SOB!! Jtpmbufe!gspn!uispbu!txbc!pg!qbujfou!jo!dsvjtf!tijq-!Kbqbo-!13.21.3131!! Tfrvfodf!JE;!MD639344/2! Query 1 CAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 28728 CAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAA 28787 Query 61 AGGCTTCTACGCAGAAGGGAGCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 28788 AGGCTTCTACGC A GAAGGGAGCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACG 28847 Query 121 TAGTCGCAACAGTTCAAGAAATTCAACTCCAGGCAGCAGTAGGGGAACTTCTCCTGCTAG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 28848 TAGTCGCAACAGTT C AAGAAATTCAACTCCAGGCAGCA G TAGGGGAACTTCTCCTGCTAG 28907 Query 181 AATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 28908 AATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCA 28967 Query 241 GCTTGAGAGCAAAATGTCTGGTAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 28968 GCTTGAGAGCAAAATGTCTGGTAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAA 29027 Query 301 ATCTGCTGCTGAGGCTTCTAAGAAGCCTCGGCAAAAACGTACTGCCACTAAAGCATACAA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 29028 ATCTGCTGCTGAGGCTTCTAAGAAGCCTCGGCAAAAACGTACTGCCACTAAAGCATACAA 29087 Query 361 TGTAACACAAGCTTTCGGCAGACGTGGTCCAGAACAAA 398 |||||||||||||||||||||||||||||||||||||| Sbjct 29088 TGTAACACAAGCTTT C GGCAGACGTGGTCCAGAACAAA 29125 NOTE: This 398-base sequence is identical to that of the Wuhan seafood market pneumonia virus, isolated in December 2019, GenBank Sequence ID: NC_045512.2 SARS CoV-2 isolates in the USA may have following single-base mutations in this segment at the positions typed in red (Sequences were retrieved from NCBI Databases). 29103 C>T Sputum of patient, TX, USA, 02-11-2020 Sequence ID: MT106054 28886 G>A Nasopharyngeal swab, CA, USA, 02-06-2020 Sequence ID: MT106052 28862 C>T Oropharyngeal swab, MA, USA, 01-29-2020 Sequence ID: MT039888 28792 A>T Nasopharyngeal swab, CA, USA, 01-23-2020 Sequence ID: MN994467 Ћ Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!2:!pg!34 Ќ Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!31!pg!34 Please inform your affiliated laboratories that we are now in position to assist them to resolve their questionable RT-qPCR test results with high Ct values (between 37 and 40) if they are able to send us 10 µL of the residual RNA extract kept at -80°C in dry ice package. We will perform a nested RT-PCR on each of received residual samples, and perform a bi-directional Sanger sequencing on all positive cases and report the results back to the sender. Contact person is: Sin Hang Lee, MD email shlee01@snet.net Sincerely, Sin Hang Lee, MD, F.R.C.P.(C) References 1. Martí NB, Del pozo ES, Casals AA, Garrote JI, Masferrer NM. False-positive results obtained by following a commonly used reverse transcription-PCR protocol for detection of influenza A virus. J Clin Microbiol. 2006;44(10):3845. 2. Pas SD, Patel P, Reusken C, et al. First international external quality assessment of molecular diagnostics for Mers-CoV. J Clin Virol. 2015;69:8185. 3. Jiang SS, Chen TC, Yang JY, et al. Sensitive and quantitative detection of severe acute respiratory syndrome coronavirus infection by real-time nested polymerase chain reaction. Clin Infect Dis. 2004;38(2):293296. 4. Nao, N., et al. Detection of second case of 2019-nCoV infection in Japan. 2020. https://www.who.int/docs/default-source/coronaviruse/method-niid-20200123-2.pdf?sfvrsn=fbf75320_7 Ѝ Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!32!pg!34 EXHIBIT 3 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!33!pg!34 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!34!pg!34 Clerk of the Board Andy Pickett Chief Administrative Officer and Clerk of the Board 25 County Center Drive, Suite 200 T: 530.552.3300 buttecounty.net/administration Oroville, California 95965 F: 530.538.7120 Members of the Board Bill Connelly | Debra Lucero | Tami Ritter | Tod Kimmelshue | Doug Teeter MEMORANDUM DATE: February 11, 2021 RE: Public Comment Submitted for February 9, 2021 Butte County Board of Supervisors Meeting Item 7 – Board of Supervisors Closed Session Pursuant to current State Public Health directives to shelter-in-place and practice social distancing due to the COVID19 pandemic, and as authorized by Governor Gavin Newsom’s Executive Orders N-25-20 and N-29-20, the meeting was closed to the public and all non-essential County staff. Members of the public were encouraged to participate remotely from a safe location by submitting comments electronically. Enclosed please find all public comment related to Item 7 at the February 9, 2021 Board of Supervisors Meeting. Amy Schuman Associate Clerk of the Board Clerk of the Board Andy Pickett Chief Administrative Officer and Clerk of the Board 25 County Center Drive, Suite 200 T: 530.552.3300 buttecounty.net/administration Oroville, California 95965 F: 530.538.7120 Members of the Board Bill Connelly | Debra Lucero | Tami Ritter | Tod Kimmelshue | Doug Teeter MEMORANDUM DATE: February 10, 2021 RE: Public Comment Submitted for February 9, 2021 Butte County Board of Supervisors Meeting during the In-Home Supportive Services Public Authority Board Agenda Item 4 Public Comment and Item 5 Closed Session Pursuant to current State Public Health directives to shelter-in-place and practice social distancing due to the COVID19 pandemic, and as authorized by Governor Gavin Newsom’s Executive Orders N-25-20 and N-29-20, the meeting was closed to the public and all non-essential County staff. Members of the public were encouraged to participate remotely from a safe location by submitting comments electronically. Enclosed please find all public comment related to Items 4 and 5 at the February 9, 2021 Board of Supervisors Meeting during the In-Home Supportive Services Public Authority Board Agenda. Amy Schuman Associate Clerk of the Board From:Snyder, Ashley To:Schuman, Amy;Paulsen, Shaina Subject:FW: Comments For Board of Supervisors 2/10/2021 Date:Tuesday, February 23, 2021 9:47:51 AM Attachments:Dr.-Lee-File-Stamped SARS-CoV-2 PCR Test Appeal 23pg.pdf Public Comment BOS meeting 2-10-2021 Sascha Sarnoff.pdf I missed a public comment. Oops. I guess I am human. Shaina, when you have time (within the next 2 weeks) would you amend the public comment packet to include this? Thanks Ashley N. Snyder Assistant Clerk of the Board Butte County Administration 25 County Center Drive, Suite 200, Oroville, CA 95965 T: 530.538.2867 | F: 530.538.7120 Twitter | Facebook | YouTube | Pinterest From: Sascha Anya <qwave@protonmail.com> Sent: Tuesday, February 9, 2021 9:01 AM To: Snyder, Ashley <ansnyder@buttecounty.net> Subject: Comments For Board of Supervisors 2/10/2021 ATTENTION: This message originated from outside Butte County. Please exercise judgment before opening .. attachments, clicking on links, or replying. Dear Clerk of the Board, Agenda Item 6. Re Public Comment BOS meeting 2/10/2021 Please forward my letter addressed to Butte County Counsel, County Board of Supervisors, and County Public Health. Additionally please put a copy of this letter, along with any links and attachments into the public record. Thanks! Sascha Sarnoff, Advocate Chico Environmental Health Advocacy ________________________________ (805) 500-6820qwave@protonmail.com Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!2!pg!34 UNITED STATES DISTRICT COURT SOUTHERN DISTRICT OF NEW YORK ADRIANA AVILES, Individually and as Parent and Natural Guardian of N.A., N.A. and A.A., STEPHANIE DENARO, Individually and as Parent and Natural Guardian of D.D. and H.D., CHRISTINE KALIKAZAROS, Individually and as Parent and Natural Guardian of Y.K., GAETANO LA MAZZA, Individually and as Parent and Natural Guardian of R.L., CRYSTAL LIA, Individually and as Parent and Natural Guardian of F.L., and HEALTH DEFENSE, DECLARATION OF SIN HANG Plaintiffs, LEE, MD Against Civil No.: BILL de BLASIO of the City of New York, DR. DAVID CHOKSHI, in City of New York, NEW YORK CITY DEPARTMENT OF EDUCATION, RICHARD A. CARRANZA the New York City Department of Education and THE CITY OF NEW YORK, Defendants. I, Sin Hang Lee, MD declare as follows: 1. I am a pathologist and research scientist based in Connecticut who has been developing DNA sequencing-based molecular tests to diagnose infectious diseases that are difficult to diagnose, such as Lyme disease and human papilloma virus (HPV) infection. 2. has published scores of scientific articles in peer-reviewed journals. 3. Exhibit 1 is a true and accurate copy of my current CV. 1 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!3!pg!34 4. It is my professional opinion that the need for accurate coronavirus testing is imperative. It is especially critical in nursing homes and institutions caring for elderly patients, so that false-positive patients are not housed with true- ensure that staff in direct contact with highly susceptible patients be infection-free. 5. I have been working diligently to overcome the roadblocks in coronavirus testing. 6. As early as March 2020, I wrote to the WHO and to Dr. Anthony Fauci at the National Institute of Allergies and Infectious Diseases of the National Institutes of Health (NIH) to explain why the current tests to detect SARS-CoV-2 RNA are generating false positives and negatives. The letter explained that a two- no- correct copy of that letter is attached as Exhibit 2. The method I used was subsequently published in a peer-reviewed international journal based in Japan. 7. It is my opinion, one supported by the FDA, that questionable or false RT-qPCR test results can be investigated and resolved by Sanger sequencing, the testing method I developed. 8. Given the specificity of my letter, with its DNA sequencing electropherograms and its significance for preventing disease spread, it is almost unbelievable that as of the date of this declaration, I have received no response from either the WHO or NIH. 9. In April 2020, I reached out to the Connecticut Department of Public Health to receive patient samples for further validation testing. I re-tested 20 reference patient samples supplied by the Connecticut Department of Public Health on April 30, 2020, and found that 3 of 10 reference samples initially classified as positive for SARS-CoV-2 by RT-qPCR test were false positives and 2 of 10 reference samples initially classified as negative were found to 2 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!4!pg!34 contain SARS-CoV-2 proven by DNA sequencing. These results were reported to the Connecticut Department of Public Health and published on July 17, 2020. Four days later on July 21, 2020, the Connecticut Department of Public Health also reported that a total of 90 out of 144 people tested between June 15 and July 17, many of whom were nursing home residents, received false-positive SARS-CoV-2 RT-qPCR test results because of a flaw in the test used at Gabrielle Fonrouge, Connecticut lab finds 90 positive COVID-19 tests were false: report, N EW Y ORK P OST (Jul. 21, 2020), https://nypost.com/2020/07/21/connecticut-testing-lab-botches-dozens-of-coronavirus-tests/. Attached as Exhibit 3 is a true and correct link to that article. 10. There is ample evidence that the currently used RT-qPCR tests are inaccurate for determining if a -CoV-2, the virus causing COVID-19. The inherent flaw of PCR for the detection of SARS-CoV-2 RNA is further discussed as follows. 11. PCR (polymerase chain reaction) is a chemical reaction used to duplicate a defined segment of DNA exponentially in the test tube. To detect or to analyze a segment of target DNA molecule in question is usually by DNA sequencing, the process of determining the orders of the nucleotides (As, Ts, Cs, and Gs), which link up as a chain in the target DNA molecule. 12. However, the current technology cannot analyze one or a few DNA molecules in the sample being tested. These DNA molecules must be amplified, or made larger in number by a duplicating process to reach a mass of identical molecules to be analyzed. This amplification process, commonly referred to as PCR, is what Kary Mullis discovered, and consists of multiplying sequentially and exponentially by doubling the target DNA segment present in a test tube. So, 2 becomes 4, then becomes 8, then 16, and so forth, using newly formed copies as the 3 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!5!pg!34 templates to make more new copies of the same molecule continuously. In such a duplication manner, each molecule of DNA in the original sample can become more than 1 billion copies after 30 cycles of amplification, in theory. 13. As noted, PCR multiplies DNA. But the genetic material that comprises the genome of SARS-CoV-2, the virus causing COVID-19, is RNA that is much more labile or unstable than DNA. It must be converted to DNA in order to utilize the PCR process. This is accomplished by action of an enzyme called reverse transcriptase (RT) in the first of four steps involved in the process. RT thus allows a single strand of RNA to be reverse-transcribed into a complementary strand of DNA, cDNA in short. The process of RT acting on RNA, leading to cDNA amplification through PCR, is called RT-PCR, which should be distinguished from RT- qPCR or rRT-PCR, the method currently being used for SARS-CoV-2 PCR testing. 14. The principle of PCR is based on primer-initiated and template-directed enzymatic polymerization of nucleotides. That means that there must be a segment of single- stranded DNA (ssDNA) serving as the template to direct the nucleotide incorporation for the synthesis of the new ssDNA whose sequence is complementary to the template. It also means that the synthesis of the new ssDNA must start with a primer, which is an oligonucleotide of about 20 nucleotides long and complementary to a segment of the target template DNA, annealing to (attached to) the target DNA at one of the two beginning sites of the target DNA to be amplified. Without a primer, the enzyme, DNA polymerase, will not work. In other words, PCR begins with enzymatic primer extension. The enzyme, a DNA polymerase, works like a type writer adding t 4 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!6!pg!34 15.The primer/template annealing process of PCR is based on DNA/DNA hybridization by forming hydrogen bonds between all complementary base pairs of the primer and template. However, DNA/DNA hybridization or annealing can take place even if there is only a partial match in base pairs between a primer and an unintended DNA in the PCR mixture in the absence of a fully matched target DNA template. Under certain circumstances the DNA polymerase can amplify an unintended (undesirable) DNA with a pair of partially matching primers and generate unintended (undesirable) PCR products. If the PCR products are not further analyzed for confirmation, false-positive test results may be produced. 16.The endpoint of an RT-qPCR test is arbitrarily set by the test kit manufacturer, of this sim incomprehensible. 17.I agree with Dr. Michael Mina, assistant professor of epidemiology at the Harvard T. H. Chan School of Public Health, who is quoted in the New York Post article as saying that the following discussion of the amplification process, sometimes also referred to as cycles. Dr. Mina is quoted in the Harvard Magazine (8/3/20) as saying that Current PCR testing detects virus genome- the results are virtually useless for public health efforts to contain the raging epidemic 5 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!7!pg!34 18. Tests with thresholds so high may detect not only live virus, but also simple genetic fragments, leftover from past infection that poses no risk for current exposure to others, or from other unrelated nucleic acids in the sample. 19. I agree with virologist Dr. Juliet Morrison that any test with a cycle threshold above 35 is too sensitive (in other words will read positive when the individual is not infectious). 20. I am of the opinion that it would be quite easy and simple to manipulate the number of positive results with this form of testing by the test kit manufacturers to please their customers whose business benefits from a high number of COVID-19 cases. 21. I believe that with varying numbers of cycles or amplifications being used in different states or even in different health systems in one state, it would be quite easy and simple to manipulate the number of positive results with this form of testing by simply changing the number of cycles to a higher number to produce the appearance of worsening or to a lower one to produce lower infection numbers. I agree with some experts who say that if over 40 amplifications be used, 100% of people tested might turn out to be positive. 22. I believe that the currently used RT-qPCR is a faulty diagnostic test, For example, an individual who gets a positive test result in a facility or area that is using a test setting the cutoff at 37 cycles might fly to another area where repeat testing is using a cutoff at 30 cycles - location one does not have it after flying to the second location. 23. This reveals the absurdity of the RT-qPCR based test. 24. To have children to take such an unreliable test is equally absurd. 6 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!8!pg!34 I declare under penalty of perjury under the laws of the United States of America that the foregoing is true and correct. th Executed this 15 day of December, 2020 in Milford, Connecticut. Signed ___________________________________ Sin Hang Lee, MD 7 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!9!pg!34 EXHIBIT 1 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!:!pg!34 CURRICULUM VITAE NAME: SIN HANG LEE, M.D., F.R.C.P. (C), F.C.A.P. OFFICE ADDRESS: Milford Molecular Diagnostics Laboratory 2044 Bridgeport Avenue, Milford, CT 06460 PLACE OF BIRTH: HONG KONG CITZENSHIP: NATURALIZED U.S. CITIZEN 1976 EDUCATION Tongji University College of Medicine and Wuhan Medical College (combined since 1952) Shanghai and Hankow, Hubei, China 1951-56 HIGH PROFESSIONAL DEGREE F.R.C.P. (C) Royal College of Physicians and Surgeons of Canada 1966 POSTGRADUATE TRAINING and EXPERIENCE Teaching assistant in microbiology, Sichuan Medical College and Guiyang Medical College, China 1956-61 Demonstrator in pathology, University of Hong Kong, School of Medicine, Hong Kong 1961-63 Rotating clinical intern, South Baltimore General Hospital, Baltimore, MD 1963-64 Resident, Assistant Pathologist and Pathologist at New York Hospital, Cornell Medical Center, New York, NY 1964-67 Pathology Fellow at Memorial Hospital for Cancer and Allied Diseases, New York, NY 1967-68 Assistant Professor of Pathology, McGill University, Montreal, Canada 1968-71 Associate Professor of Pathology, Yale University, New Haven, CT 1971-73 1 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!21!pg!34 Attending Pathologist at Hospital of St.Raphael and Associate Clinical Professor of Pathology, Yale University, New Haven, CT 1973-2003 Pathologist at Milford Hospital, Milford, CT 2004- 2015 Director, Milford Medical Laboratory, Inc. Milford, CT 2008- 2015 Director, Milford Medical Laboratory Molecular Diagnostic Section 2008- 2015 Director, Milford Molecular Diagnostics Laboratory 2015- MEDICAL LICENSURE: District of Columbia, New York and Connecticut (current), U.S.A. Licentiate of the Medical Council of Canada Certificate of full registration, General Medical Council, London, Great Britain SPECIALTY BOARDS: Diplomate, American Board of Pathology (AP) 1966 Certificated Specialist in General Pathology (AP and CP) Canada 1966 Expertise: General pathology, surgical pathology, clinical microbiology, and molecular diagnostics by PCR/direct DNA sequencing. PUBLICATIONS: 1. Lee, S.H. Properdin (in Chinese) Chinese Med J. 8:796-799. 1958. 2. -und -J. Otte and W. Köhler Veb Gustav Fischer Verlag-Jena. 1958, Peoples Hygiene Publisher, Beijing, China, 1961. 3. 17:37-40, 1963. 4. Lee, S.H. Histochemical demonstration of glutamic oxalacetic transaminase. Amer. J. Clin. Path. 49: 568-572. 1968. 5. Lee, S.H. and Torack, R.M. Aldehyde as fixative for histochemical study of glutamic oxalacetic transaminase. Histochem. 12: 341-344, 1968. 6. Lee, S.H. and Torack, R.M. The effects of lead and fixatives of glutamic oxalacetic transaminase. J. Histochem. 16: 181-184, 1968. 7. Lee, S.H. and Torack, R.M. Electron microscope studies of glutamic oxalacetic transaminase in rat liver cell. J. Cell Biol. 39: 716-724. 1968. 2 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!22!pg!34 8. Lee, S.H. and Torack, R.M. A biochemical and histochemical study of glutamic oxalacetic transaminase activity of rat hepatic mitochondria fixed in situ and in vitro. J. Cell Biol. 39: 716-724. 1968. 9. Lee, S.H. Ultrastructural localization of glutamic oxalacetic transaminase activity in cardiac muscle fiber and cardiac mitochondrial fraction of the rat. Histochem. 19: 99-109. 1969. 10. Lee, S.H. The possible role of the vesicles in renal ammonia excretion. J. Cell Biol. 45: 644-649. 1970. 11. Lee, S.H. Cytochemical study of in vivo inhibition of hepatic glutamic oxalacetic transaminase by hydrazine. Beitr. Path. 141: 99-106. 1970 12. Lee, S.H. and Aleyassine, H. Hydrazine toxicity in pregnant rats. Arch. Environ. Health 21: 615-619. 1970. 13. Chak, S.P. and Lee, S.H. Ultrastructural localization of glutamic oxaloacetic transaminase activity in adrenal cortical cell of rat. J. Ultrastructure Res. 35: 265-273. 1971. 14. Lee, S.H. and Aleyassine, H. Morphologic changes in the liver of mice bearing Ehrlich ascites tumor: Lab. Invest. 24: 513-522. 1971. 15. Aleyassine, H. and Lee, S.H. Inhibition by hydrazine, phenelzine and pargyline of insulin release from rat pancreas. Endocrinol. 89: 125-129. 1971 16. Lee, S.H., Dusek, J. and Rona, G. Electron microscopic cytochemical study of glutamic oxalacetic transaminase activity in ischemic myocardium. J. Mol. Cell. Cardiol. 3: 103-109. 1971. 17. Aleyassine, H. and Lee, S.H. Inhibition of insulin release by substrates and inhibitors of monoamine oxidase. Amer. J. Physiol. 222: 565-569. 1972. 18. Lee, S.H. Isolation of parietal cells from glutaraldehyde-fixed rabbit stomach. J. Histochem. Cytochem. 20: 634-643. 1972. 19. Hayat, ed.). VoL. I. pp.116-130. Van Nostrand Reinhold Co., New York. 1973. 20. Lee, S.H. Ultracytochemistry of the mitochondrial glutamate oxalacetate transaminase th activity. pp. 107-108. Proc. 4 Internatl. Congr. Histochem., Kyoto, Japan. 1972. 21. Schachter, E.N., smith, G.J.W., Cohen, G.S., Lee, S.H., Lasser, A. and Gee, J.B.L. Pulmonary granulomas in a patient with pulmonary veno-occlusive disease. Chest 67: 487-489. 1975. 3 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!23!pg!34 22. Lee, S.H. Estrogen binding of human breast cancer cells studied with a fluorescent estradiol conjugate. Fed. Proc. 37:462. 1978 (abstr.) 23. Lee, S.H. Cytochemical study of estrogen receptor in human breast cancer. Amer. J. Clin. Path. 70: 197-203. 1978. 24. Lee, S.H. Determination of breast cancer cell estrogen receptor in frozen sections. Lab. Invest. 40:268. 1979 (Abstr.) 25. Lee, S.H. Simultaneous detection of estrogen and progesterone receptors in breast cancer cells. Fed. Proc. 38:913. 1979 (Abstr.) 26. Lee, S.H. Cancer cell estrogen receptor of human mammary carcinoma. Cancer 44:1-12. 1979. 27. Lee, S.H. Cellular estrogen and progesterone receptors in mammary carcinoma. Amer. J. Clin. Path. 73:323-329. 1980. 28. Lee, S.H. Hydrophilic macromolecules of steroid derivatives for the detection of cancer cell receptors. Cancer 46:2825-2828. 1980. 29. Lee, S.H. Estrogen and progesterone receptors in breast cancer A new approach to measure. Connecticut Med. 44:622-625. 1980. 30. Lee, S.H. Sex-steroid hormone receptors on mammary carcinoma. In Masson Monographs in Diagnostic Pathology. Diagnostic Immunohistochemistry. Ed. R. A. DeLellis. pp.149-164. Masson Publishing USA, Inc., New York. 31. Lee, S.H. The histochemistry of estrogen receptors. Histochem. 71:491-500. 1981. 32. Lee, S.H. Histochemical estrogen receptor assay. Amer. J. Clin. Path. 76:365. 1981 33. Lee, S.H. Prospects for histochemical assay of steroid receptors In Endocrine Relationships in Breast Cancer. Ed. B. A. Stoll. pp.144-155. 1982 William Heinemann Medical Books LTD, London 34. Lee, S.H. Estrogen receptor-rich neuroglia of the rat brain. Lab. Invest. 46:49A 1982 (Abstr.) 35. Lee, S.H. Uterine epithelial and eosinophil estrogen receptors in rats during estrous cycle. Histochem. 74:443-452. 1982. 36. Lee, S.H. Estrogen-primed immature rat uterus a tissue control for histochemical receptor assay. Amer. J. Clin. Path. 79:484-486. 1983. 4 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!24!pg!34 37. Lee, S.H. Augmentation and depletion of cytoplasmic estrogen-binding sites as visualized by histochemical technique. J. Steroid Biochem. 19:31S. 1983 (Abstr.) 38. Lee, S.H. Validity of a histochemical estrogen receptor assay. Supported by the observation of a cellular response to steroid manipulation. J. Histochem. Cytochem. 32:305-310. 1984. 39. Benz, C., Wiznitzer, I. and Lee, S.H. Flow cytometric analysis of fluorescein-conjugated estradiol (E-BSA-FITC) binding in breast cancer suspensions. Cytometry 6:260-267. 1985. 40. Lee, S.H. Histochemical study of estrogen receptors in the rat uterus with a hydrophilic fluorescent estradiol conjugate. Localization of Putative Steroid Receptors. Vol. I. Eds. L.P. Pertschuk and S.H. Lee. CRC Press, Inc., Boca Raton, USA pp 59-83. 1985. 41. Lee, C., Jesik, J., Mangkornkanok, M., Sensibar,J. and Lee, S.H. Estrogen receptors and hormone responsiveness in serially transplanted mammary tumors in rats. Localization of putative Steroid Receptors. Vol. I Eds. L.P. Pertschuk and S.H. Lee. CRC Press, Inc. Boca Raton, USA, pp 85- 42. Benz, C., Wiznitzer, I. and Lee, S.H. Flow cytometric analysis of fluorescent estrogen binding in cancer call suspensions. Localization of Putative Steroid Receptors. Vol. I Eds. L.P. Pertschuk and S.H. Lee, CRC Press, Inc. Boca Raton, USA. pp.95-110. 1985. 43. Lee, S.H. A fluorescent histochemical study of steroid receptors in human breast cancer. Localization of Putative Steroid Receptors. Vol. II Eds. L.P. Pertschuk and S.H. Lee. CRC Press, Inc. Boca Raton, USA pp. 37-50. 1985. 44. Lee, S.H., Charoenying, S., Brennan, T., Markowski, M. and Mayo, D.R. Comparative studies of three serologic methods for the measurement of Mycoplasma pneumoniae antibodies. Amer. J. Clin. Pathol. 92:342-347. 1989. 45. Lee, S.H. Coexistence of cytoplasmic and nuclear estrogen receptors. A histochemical study in human mammary cancer and rabbit uterus. Cancer 64:1461-1466. 1989. 46. Keefe, D.L., Michelson, D.S., Lee, S.H. AND Naftolin, F. Astrocytes within the hypothalamic arcuate nucleus contain estrogen-sensitive peroxidase, bind fluorescein-conjugated estradiol and may mediate synaptic plasticity in the rat.Amer. J. Obstet. Gynecol. 1991; 164:959-966. 47. Rao SK, Caride VJ;, Ponn R, Giakovis E, Lee H. F-18 fluorodeoxyglucose positron emission tomography-positive benign adrenal cortical adenoma: imaging features and pathologic correlation. Clinical nuclear medicine 2004;29:300-2. 48. Lee SH. Green tea consumption and mortality in Japan. JAMA 2007;297(4):360. 49. Lee SH. Expanded use of human papillomavirus testing in gynecologic practice. Amer J Clin Path. 2007;128(5):883-4. 5 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!25!pg!34 50. Lee, S. H., Vigliotti, V.S., Vigliotti, J.S. and Pappu, S. Routine human papillomavirus genotyping by DNA sequencing in community hospital laboratories. Infect Agent Cancer 2007; 2:11. 51. Lee, S. H., Vigliotti, V.S., and Pappu, S. DNA Sequencing Validation of Chlamydia trachomatis and Neisseria gonorrhoeae Nucleic Acid Tests. Am J Clin Pathol. 2008;129:852-859. 52. Lee S.H., Vigliotti V.S., Pappu S. Human papillomavirus (HPV) infection among women in a representative rural and suburban population of the United States. Inter J Gyn Ob. 2009; 105:210- 214. 53. Lee, S.H., Vigliotti, V.S., and Pappu, S. Molecular tests for human papillomavirus (HPV), Chlamydia trachomatis and Neisseria gonorrhoeae in liquid-based cytology specimen. BMC 2009; 9:8. 54. Lee, S. H., Vigliotti, V.S., Vigliotti, J.S. and Pappu, S. Validation of human papillomavirus genotyping by signature DNA sequence analysis. BMC Clin Pathol 2009; 9:3. 55. Lee SH. HPV test is a virology test, not for predicting cancer. In Castle PE. The evolving definition of carcinogenic human papillomavirus Infect Agent Cancer 2009, 4:7. 56. Lee, S.H., Vigliotti, V.S., and Pappu, S. Signature sequence validation of human papillomavirus type 16 (HPV-16) in clinical specimens. J Clin Path. 2010;63:235-239. 57. Lee SH. HPV DNA test utilization.Am J Clin Path 2010;133(2):339. 58. Lee, S. H., Vigliotti, V.S., Vigliotti, J.S., Jones W. and Pappu, S. Increased Sensitivity and Specificity of Borrelia burgdorferi 16S Ribosomal DNA Detection. Am J Clin Path. 2010; 133:569-576. 59. Lee SH. From human papillomavirus to cervical cancer. Obstet Gynecol 2010; 116:1221-1222. 60. Lee, S. H., Vigliotti, V.S., Vigliotti, J.S., Jones, W., Williams, J., Walshon, J. Early Lyme disease with spirochetemia diagnosed by DNA sequencing. BMC Res Notes. 2010 Nov 1; 3:273. 61. Lee SH, Castle PE, Stoler M, Kinney W. Patient Safety and the Next Generation of HPV DNA Tests. Am J Clin Pathol. 2011 Mar;135(3):481. 62. Lee SH: Guidelines for the use of molecular tests for the detection and genotyping of human papilloma virus from clinical specimens. Methods Mol Biol 2012; 903:65-101. 63. Lee SH. Detection of human papillomavirus (HPV) L1 gene DNA possibly bound to particulate aluminum adjuvant in the HPV vaccine Gardasil®. J Inorg Biochem 2012; 117:8592. 6 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!26!pg!34 64. Lee SH. Detection of human papillomavirus L1 gene DNA fragments in postmortem blood and spleen after Gardasil® vaccination-A case report. Advances in Bioscience and Biotechnology 2012; 3: 1214-1224. 65. Lee SH. Topological conformational changes of human papillomavirus (HPV) DNA bound to an insoluble aluminum salt a study by low temperature PCR. Advances in Biological Chemistry 2013; 3: 76-85. 66. Hong G, Lee SH, Ge S, Zhou S. A Novel Low Temperature PCR Assured High-Fidelity DNA Amplification. International Journal of Molecular Sciences. 2013; 14:12853-12862. 67. Lee SH. Melting profiles may affect detection of residual HPV L1 gene DNA fragments in Gardasil®. Curr Med Chem. 2014; 21:932-940. 68. Lee SH, Vigliotti JS, Vigliotti VS, Jones W, Shearer DM. Detection of Borreliae in Archived Sera from Patients with Clinically Suspect Lyme Disease. International Journal of Molecular Sciences. 2014; 15:4284-4298. 69. Lee SH, Vigliotti JS, Vigliotti VS, Jones W, Moorcroft TA, Lantsman K. DNA Sequencing Diagnosis of Off-Season Spirochetemia with Low Bacterial Density in Borrelia burgdorferi and Borrelia miyamotoi Infections. International Journal of Molecular Sciences. 2014; 15:11364- 11386. 70. Lee SH, Vigliotti JS, Vigliotti VS, Jones W. From human papillomavirus (HPV) detection to cervical cancer prevention in clinical practice. Cancers (Basel). 2014; 6(4):2072-2099. 71. Lee SH, Zhou S, Zhou T, Hong G. Sanger Sequencing for BRCA1 c.68_69del, BRCA1 c.5266dup and BRCA2 c.5946del Mutation Screen on Pap Smear Cytology Samples. International Journal of Molecular Sciences. 2016; 17(2):229. 72. Lee SH. Lyme disease caused by Borrelia burgdorferi with two homeologous 16S rRNA genes: a case report. International Medical Case Reports Journal. 2016; 9:101106. 73. Lambert JS, Cook MJ, Healy JE, Murtagh R, Avramovic G, Lee SH. Metagenomic 16S rRNA gene sequencing survey of Borrelia species in Irish samples of Ixodes ricinus ticks. PLoS One. 2019;14:e0209881. 74. Lee SH, Healy JE, Lambert JS. Single Core Genome Sequencing for Detection of both Borrelia burgdorferi Sensu Lato and Relapsing Fever Borrelia Species. Int J Environ Res Public Health. 2019;16: E1779. 75. Lee S.H. Testing for SARS-CoV-2 in cellular components by routine nested RT-PCR followed by DNA sequencing. International Journal of Geriatrics and Rehabilitation. 2020; 2::69- 96. 7 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!27!pg!34 EXHIBIT 2 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!28!pg!34 Sin Hang Lee, MD, F.R.C.P.(C) Milford Molecular Diagnostics Laboratory 2044 Bridgeport Avenue Milford, CT 06460 USA March 22, 2020 Dr. Margaret Harris The World Health Organization's coronavirus response team harrism@who.int Dr Eduardo Guerrero WHO Regional Office for the Americas guerrere@paho.org Dr. Anthony S Fauci af10r@nih.gov Extremely sensitive, no false-positive tests needed for SARS-CoV-2 Dear Drs. Harris, Guerrero and Fauci: It has been widely reported in the social media that the RT-qPCR test kits used to detect SARS- CoV-2 RNA in human specimens are generating many false positive results and are not sensitive enough to detect some real positive cases, especially during convalescence. RT-qPCR is known to generate false positive results when used to detect influenza A virus \[1\] and MERS-CoV, \[2\] another Coronavirus. Without a nested (two-round) PCR, a single round RT-PCR may miss real infections caused by SARS-CoV \[3\] and by SARS-CoV-2 \[4\]. The major technical flaw of RT-qPCR for molecular diagnosis is the limitation of the length of its DNA probe which is about 25 bases long or shorter. And hybridization is not an accurate method to determine nucleotide sequences, the foundation of all nucleic acid-based diagnostics. This letter recommends that the WHO coronavirus response team adopt or develop a nested RT- qPCR protocol to generate a cDNA PCR amplicon to be used as the template for bi-directional sequencing. As demonstrated in this letter, nested RT-PCR is an extremely sensitive detection method and DNA sequencing will guarantee no-false positive results if all positive reports are accompanied by two-directional sequencing electropherograms, like an EKG for the diagnosis of Left Bundle Branch Block consultation. Based on information retrieved from the GenBank databases and available in the public domain, there is a unique 398-base segment in the SARS-CoV-2 nucleocapsid (N) gene which not only has a 100% match with that in the Wuhan seafood market pneumonia virus, but also contains four single-nucleotide mutations found in the viruses isolated from patients in the states of Њ Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!29!pg!34 California, Texas and Massachusetts of the U.S.A. This segment of the gene can be targeted for accurate molecular diagnosis. The nucleotide sequence of this 398-base gene segment is copied from the GenBank and re- printed here with the 4 mutated bases typed in red color. Identification of these virus isolates each with a single-base mutation in this segment may be useful in tracing the immediate source of the pathogen among patients and carriers tested positive for SARS-CoV-2. Tfwfsf!bdvuf!sftqjsbupsz!tzoespnf!dpspobwjsvt!3!TBST.DpW.3!SOB!! Jtpmbufe!gspn!uispbu!txbc!pg!qbujfou!jo!dsvjtf!tijq-!Kbqbo-!13.21.3131!! Tfrvfodf!JE;!MD639344/2! Query 1 CAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 28728 CAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAA 28787 Query 61 AGGCTTCTACGCAGAAGGGAGCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 28788 AGGCTTCTACGC A GAAGGGAGCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACG 28847 Query 121 TAGTCGCAACAGTTCAAGAAATTCAACTCCAGGCAGCAGTAGGGGAACTTCTCCTGCTAG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 28848 TAGTCGCAACAGTT C AAGAAATTCAACTCCAGGCAGCA G TAGGGGAACTTCTCCTGCTAG 28907 Query 181 AATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 28908 AATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCA 28967 Query 241 GCTTGAGAGCAAAATGTCTGGTAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 28968 GCTTGAGAGCAAAATGTCTGGTAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAA 29027 Query 301 ATCTGCTGCTGAGGCTTCTAAGAAGCCTCGGCAAAAACGTACTGCCACTAAAGCATACAA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 29028 ATCTGCTGCTGAGGCTTCTAAGAAGCCTCGGCAAAAACGTACTGCCACTAAAGCATACAA 29087 Query 361 TGTAACACAAGCTTTCGGCAGACGTGGTCCAGAACAAA 398 |||||||||||||||||||||||||||||||||||||| Sbjct 29088 TGTAACACAAGCTTT C GGCAGACGTGGTCCAGAACAAA 29125 NOTE: This 398-base sequence is identical to that of the Wuhan seafood market pneumonia virus, isolated in December 2019, GenBank Sequence ID: NC_045512.2 SARS CoV-2 isolates in the USA may have following single-base mutations in this segment at the positions typed in red (Sequences were retrieved from NCBI Databases). 29103 C>T Sputum of patient, TX, USA, 02-11-2020 Sequence ID: MT106054 28886 G>A Nasopharyngeal swab, CA, USA, 02-06-2020 Sequence ID: MT106052 28862 C>T Oropharyngeal swab, MA, USA, 01-29-2020 Sequence ID: MT039888 28792 A>T Nasopharyngeal swab, CA, USA, 01-23-2020 Sequence ID: MN994467 Ћ Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!2:!pg!34 Ќ Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!31!pg!34 Please inform your affiliated laboratories that we are now in position to assist them to resolve their questionable RT-qPCR test results with high Ct values (between 37 and 40) if they are able to send us 10 µL of the residual RNA extract kept at -80°C in dry ice package. We will perform a nested RT-PCR on each of received residual samples, and perform a bi-directional Sanger sequencing on all positive cases and report the results back to the sender. Contact person is: Sin Hang Lee, MD email shlee01@snet.net Sincerely, Sin Hang Lee, MD, F.R.C.P.(C) References 1. Martí NB, Del pozo ES, Casals AA, Garrote JI, Masferrer NM. False-positive results obtained by following a commonly used reverse transcription-PCR protocol for detection of influenza A virus. J Clin Microbiol. 2006;44(10):3845. 2. Pas SD, Patel P, Reusken C, et al. First international external quality assessment of molecular diagnostics for Mers-CoV. J Clin Virol. 2015;69:8185. 3. Jiang SS, Chen TC, Yang JY, et al. Sensitive and quantitative detection of severe acute respiratory syndrome coronavirus infection by real-time nested polymerase chain reaction. Clin Infect Dis. 2004;38(2):293296. 4. Nao, N., et al. Detection of second case of 2019-nCoV infection in Japan. 2020. https://www.who.int/docs/default-source/coronaviruse/method-niid-20200123-2.pdf?sfvrsn=fbf75320_7 Ѝ Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!32!pg!34 EXHIBIT 3 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!33!pg!34 Dbtf!2;31.dw.1:93:.QHH!!!Epdvnfou!23.2!!!Gjmfe!23028031!!!Qbhf!34!pg!34 Dear Clerk of the Board, Please forward the attached letter to Butte County Counsel, Butte County Board of Supervisors, and Butte County Public Health. Additionally, please place a copy of my email along with all attachments to the public record. Thank you for your kind assistance. Item 6. Agenda Item Board of Supervisors Public Comment | 2/10/2021 URGENT Request for New Motion From Board of Supervisor (BOS): Pause all new SARS-CoV-2 case-counts. Unless the County can validate and prove that RT-PCR testing for SARS-CoV-2 is a proven and accurate method to determine live, active infection the county should not be allowed to include any positive test results in the tier assessments or other analytics. Concern: Butte County Public Health misrepresenting and/or misleading the public and BOS Lawsuit declaration submitted: Dr. Lee Declaration (23 pages Attached) Motion Request: Urgent review required regarding the Butte County Public Health Department use of RT-PCR tests for counting Butte County cases of SARS-CoV-2 (and any other infections not able to be determined by these tests). As of the last two weeks, local medical labs have confirmed that nasal swap RT-PCR test results being are still produced with amplification set at 42 & 45 Ct. (cycle threshold). There no reason on earth for Butte County Public Health (BCPH) to accept any tests such as this. The test results at this amplification are entirely meaningless. Why is BOS allowing reckless testing as the basis for case-counts? Case-counts establish lock-down tiers and this amounts to intentionally misleading the public which is a fraud. I believe that BCPH is concealing the known number of infections by inflating case numbers using RT- PCR testing scheme. which in turn is causing great harm. This harm is systematically destroying please initiate a motion to re-evaluate the current system of rampant misidentification RT-PCR-based case-counts. Not a single more cases should be added to the county- wide count until a thorough scientific investigation can be made to evaluate these claims. BOS must issue a motion to BCPH to immediately halt any further RT-PCR-based case-counts BOS and staff have been notified about these siuations over the past year and yet testing remains an ongoing county problem. on numerous occasions and the staff has been made aware of this situation from the public detailing that RT-PCR tests results for SARS-CoV-2 are erroneous and fraudulent in the way they are being used. County Counsel specifically has been made aware of the misleading SARS- CoV-2 test results as data establishing lock-down tiers and the upcoming plan to set-up a county laboratory specifically for RT-PCR testing; despite scientific evidence, and product test-kit disclaimers that acknowledge the tests as inaccurate for determining active, live infections. BOS must act now. Issues Identified: 1. Laboratory Test Equipment is incapable of determining or detecting live infection/infectiousness. However, detecting live infection is the stated purpose of Butte County Public Health efforts to begin in-house county testing of the public. 2. Uninformed consent. 3. Disseminating misinformation/disinformation that is misleading BOS and the public. 4. Misappropriation of SARS-CoV-2 test result data. 5. RT-PCR is unfit-for-purpose. This nothing more than an erroneous method of testing the general public who are wholly unaware of the significant limitations of RT-PCR to determine active infection (these limitations are ignored by BCPH yet they are claimed by test-kit manufacturers for many decades.) 6. Requesting in-house RT-PCR lab equipment to conduct more fraudulent testing than is already underway, is more evidence BCPH is ignorant of the facts or just ignoring them. 7. Arbitrary and capriciously high Cycle-threshold amplification assignment without evidence of accuracy. 8. Meaningless RT-PCR test results are leading to potential lawsuits for years to come. 9. Arbitrary and inaccurate test results are already being used to manipulate the entire county and modify public behavior. Using RT-PCR for determining SARS-CoV-2 infection is highly deceptive and would likely be considered criminal when overwhelming evidence is presented. 10. Abusing the public trust. Erosion of public confidence in Butte County Public Health and BOS will have lasting consequences. When the public finds out about the totality of this very specific deceptive scheme there may be an uproar the like of which we can only imagine. 11. Misappropriating inaccurate RT-PCR test result data as a pretext for the continued and unsupported tier-based restrictions currently inflicting untold harm upon the unsuspecting public. 12. BCPH is abusing its power by knowingly engaging in a fraudulent scheme that misappropriates test results to inflate the case numbers. 13. BCPH operates under the pretense of preventing the spread of infectious disease and protecting public health, while in fact, BCPH is causing irreparable harm resulting in millions of dollars of damages. Butte County Public Health puts the entire county in an untenable position. 14. RT-PCR test results are fabricated through exponentially high amplification cycles which laboratory professionals and industry experts are well aware of. Thus, the people of Butte County have been completely misled and have suffered economic and social distress and damages because Butte County is incorrectly using and interpreting false data, thus misinforming the public that a COVID- 19 emergency exists in Butte County. NYC Lawsuit | Declaration of Yale researcher and professor Dr. Lee \[23 page declaration by Dr. Lee - PDF attached\] Excerpt: In April 2020, I reached out to the Connecticut Department of Public Health to receive patient samples for further validation testing. I re-tested 20 reference patient samples supplied by the Connecticut Department of Public Health on April 30, 2020, and found that 3 of 10 reference samples initially classified as positive for SARS-CoV-2 by RT-qPCR test were false positives and 2 of 10 reference samples initially classified as negative were found to contain SARS-CoV-2 proven by DNA sequencing. These results were reported to the Connecticut Department of Public Health and published on July 17, 2020. Four days later on July 21, 2020, the Connecticut Department of Public Health also reported that a total of 90 out of 144 people tested between June 15 and July 17, many of whom were nursing home residents, received false-positive SARS-CoV-2 RT-qPCR test results because of a flaw in the test used at COVID-19 tests were false: report, NEW YORK POST (Jul. 21, 2020), https://nypost.com/2020/07/21/connecticut-testing-lab-botches-dozens-of-coronavirus-tests/. Attached as Exhibit 3 is a true and correct link to that article. 10. There is ample evidence that the currently used RT-qPCR tests are inaccurate for -CoV-2, the virus causing COVID-19. The inherent flaw of PCR for the detection of SARS-CoV-2 RNA is further discussed as follows. Sincerely, Sascha Sarnoff, Advocate Chico Environmental Health Advocacy ________________________________ (805) 500-6820 qwave@protonmail.com